We narrowed to 42,115 results for: crispr
-
Plasmid#76463Purpose3rd generation lentiviral gRNA plasmid targeting human PFKFB3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
pROS16
Plasmid#107930PurposeHIS3 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y, gRNA-ADE2.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pU6-sgGAL4-4
Plasmid#46916PurposeHuman pSico-based U6 vector containing murine U6 promoter and sgRNA targeting GAL4 UAS promoter (negative control)DepositorInsertssgGAL4-4
Puromycin resistance and mCherry
UseCRISPR and LentiviralExpressionMammalianPromoterCMV and U6Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCfB3051(gRNA X-3 XI-2 XII-2)
Plasmid#73293PurposeEasyClone-MarkerFree guiding RNA vector to direct Cas9 to cut at sites X-3, XI-2, and XII-2DepositorInsertguiding RNA
UseCRISPR; GrnaExpressionYeastAvailable SinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pMEL17
Plasmid#107923PurposeTRP1 based Yeast/E.coli shuttle vector designed to clone and express Cas9 programming spacerDepositorInsertgRNA-CAN1.Y
UseCRISPRExpressionYeastAvailable SinceApril 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pcDNA pDEST40 Cas9-HMGB1
Plasmid#183195PurposeExpression cloneDepositorInsertHMGB1
UseCRISPRTagsCas9WTExpressionMammalianMutationn/aAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001144909)
Plasmid#76890Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001147987)
Plasmid#76075Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-sgRELA
Plasmid#83944PurposeLentiviral vector expressing an sgRNA targeting RELA NOTE: This plasmid does NOT contain Cas9.DepositorInsertsgRELA
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCK668
Plasmid#192637PurposeExpresses dCas9-NG and MCP-SoxS(R93A/S101A) on p15A-CmRDepositorInsertsSp.pCas9-dCas9-NG
BBa_J23107-MCP-SoxS(R93A, S101A)
UseCRISPR and Synthetic BiologyMutationSoxS has R93A and S101A mutations and dCas9-NG ha…PromoterBBa_J23107 and Sp.pCas9Available SinceJan. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQCas12j2
Plasmid#189780PurposeGateway entry plasmid (attL1 & attR5) expressing NLS-Cas12j2-NLS, without promoterDepositorInsertCas12j2
UseCRISPR; Gateway compatible cas12j2 entry cloneTagsNLSExpressionPlantAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
PRKAA1 gRNA (BRDN0001146526)
Plasmid#76253Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAA1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2818_Blasti_pPB: CAG-PYL1-KRAB-IRES-Blasti-WPRE-SV40PA PGK-ABI-tagBFP-SpdCas9-FKBP_F36V
Plasmid#187959PurposeExpressed ABA-inducible dimerizing KRAB-dCas9 system, with KRAB-IRES-Blasticidin resistance under CAG promoter and tagBFP-dCas9-FKBP12 (F36V mutant) degron under PGK promoter in a piggyBac plasmid.DepositorInsertsBlasticidin resistance
FKBP12_F36V
UseCRISPR and Synthetic BiologyTagsGGS linkerExpressionMammalianAvailable SinceOct. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
STK4 gRNA (BRDN0001149002)
Plasmid#76074Purpose3rd generation lentiviral gRNA plasmid targeting human STK4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
ROCK2 gRNA (BRDN0001147800)
Plasmid#76349Purpose3rd generation lentiviral gRNA plasmid targeting human ROCK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pYPQ-Cas12j2
Plasmid#173924PurposeGateway entry plasmid (attL1 & attR5) expressing NLS-Cas12j2-NLSDepositorInsertNLS-Cas12j2-NLS
UseCRISPRTagsNLSExpressionPlantAvailable SinceOct. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
PIKFYVE gRNA (BRDN0001148075)
Plasmid#76891Purpose3rd generation lentiviral gRNA plasmid targeting human PIKFYVEDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJZC32
Plasmid#62327PurposesgRNA (no RNA aptamer addition) with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 13, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSNR52-sgTET
Plasmid#46923PurposeYeast CEN/ARS vector (Ura3) that contains sgRNA controlled by SNR 52 promoter, targeting endogenous TRE elements of pTET07 promoterDepositorInsertsgRNA targeting endogenous TRE elements of pTET07 promoter
UseCRISPRExpressionYeastPromoterSNR52Available SinceOct. 1, 2013AvailabilityAcademic Institutions and Nonprofits only -
gRNA-CXCR4(90)
Plasmid#98962PurposeMammalian expression plasmid for CRISPR gRNA targeting human CXCR4 exon 2DepositorInsertCXCR4 (CXCR4 Human)
UseCRISPRExpressionMammalianMutationEncodes a gRNA for CRISPR-mediated targeting of C…PromoterU6Available SinceApril 24, 2018AvailabilityAcademic Institutions and Nonprofits only