We narrowed to 9,843 results for: CAG
-
Plasmid#204529PurposeLentiviral expression of MPL-shRNA4; gene knock down of human MPLDepositorInsertMPL-shRNA4 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA2
Plasmid#204527PurposeLentiviral expression of MPL-shRNA2; gene knock down of human MPLDepositorInsertMPL-shRNA2 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.3R/MPL-shRNA1
Plasmid#204526PurposeLentiviral expression of MPL-shRNA1; gene knock down of human MPLDepositorInsertMPL-shRNA1 (MPL Human)
UseLentiviralAvailable SinceSept. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#1
Plasmid#197424Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #1 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP_MAPRE1-KI-gRNA#2
Plasmid#197425Purposeπ-element knock-in into exon 5 of MAPRE1DepositorInsertMAPRE1 gRNA #2 (targets Exon 5) for π-element knock-in (MAPRE1 Human)
ExpressionMammalianAvailable SinceJune 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-PFKM_sgRNA1
Plasmid#201610PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertPFKM (PFKM Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-lambdaN-HA-HsTNRC6A_1-1248_H
Plasmid#146507PurposeMammalian Expression of HsTNRC6A_1-1248DepositorInsertHsTNRC6A_1-1248 (TNRC6A Human)
ExpressionMammalianMutation254-1962 truncated version of the sequence given …Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pClgn-Tesmin-BioID2-3xFLAG
Plasmid#186816PurposeMouse Clgn promoter-driven expression of TESMIN-BioID2-3xFLAGDepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pClgn-Tesmin-TurboID-3xFLAG
Plasmid#186817PurposeMouse Clgn promoter-driven expression of TESMIN-TurboID-3xFLAGDepositorAvailable SinceJan. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRps9-D95N-IRES-GFP-HygR
Plasmid#190272PurposeExpress RPS9 D95N-mutant mouse gene transcriptionally fused with eGFP. eGFP is translated from IRES.DepositorInsertribosomal protein RPS9
TagsIRES-eGFPExpressionMammalianMutationD95NPromoterCAGGS-CMVAvailable SinceOct. 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.scr_1
Plasmid#190703PurposeExpresses scrambled sgRNA and Cas9-Puro in Drosophila S2 cellsDepositorInsertScrambled sgRNA 1
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc-sgRNA-Cas9.dora_2
Plasmid#190701PurposeExpresses sgRNA targeting Dora gene and Cas9-Puro in Drosophila S2 cellsDepositorInsertdora (CG34401) sgRNA 2
UseCRISPRExpressionInsectPromoterDrosophila U6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
Cas9_ANKRD1_sgRNA2
Plasmid#186669PurposePlasmid containing Cas9 and ANKRD1 sgRNA2 , sgRNA sequence: cggtcagcttatatagct.DepositorInsertANKRD1 KO sgRNA Plasmid (ANKRD1 Human)
ExpressionMammalianAvailable SinceJuly 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSIN-Ski-gRNA1
Plasmid#180368Purposetargeting mouse Ski geneDepositorAvailable SinceJune 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgFbxw7#2/Cre
Plasmid#173636PurposeExpresses a Fbxw7-targeting gRNA and Cre-recombinaseDepositorInsertgRNA targeting Fbxw7 (Fbxw7 Mouse)
UseCRISPR, Cre/Lox, and LentiviralAvailable SinceMay 18, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-HsTNRC6A_L
Plasmid#146843PurposeInsect Expression of HsTNRC6ADepositorInsertHsTNRC6A (TNRC6A Human)
ExpressionInsectMutationA339T, K1578E compared to the sequence of isoform…Available SinceMay 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK22 pCAS-Tyr-[gRNA: 5=ARS308] (SplitHygR, AmpR)
Plasmid#179006PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitHygromycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBBK15 pCAS-Tyr-[gRNA: 5=ARS308] (SplitKanR, AmpR)
Plasmid#178999PurposeSp.Cas9 and gRNA yeast expression vector with ARS308 gRNA pre-cloned. Selection =SplitKanamycin resistanceDepositorInsertS. pyogenes Cas9
UseCRISPR and Synthetic BiologyExpressionYeastAvailable SinceMay 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA1-exon4
Plasmid#163322PurposeeCas9 ABL1 gRNA 1 (GGGGGACACACCATAGACAG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 1_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9(1.1)-ABL1-gRNA2-exon4
Plasmid#163323PurposeeCas9 ABL1 gRNA 2 (GAAGAAATACAGCCTGACGG), targeting exon 4 within the protein kinase domain of both ABL1 isoforms 1a and 1b.DepositorInsertABL1 gRNA 2_Exon4
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only