We narrowed to 31,562 results for: crispr
-
Plasmid#246294PurposeEvaluation of CiU6.3c8 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertCiU6.3c8 promoter
UseCRISPRExpressionPlantMutationA-to-C (-23 from TSS)PromoterCiU6.3c8 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-4 (nonfunctional)
Plasmid#246287PurposeEvaluation of AtU6.1c1 promoter (nonfunctional) (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertAtU6.1c1 promoter (nonfunctional)
UseCRISPRExpressionPlantMutationG-to-C at -15 from TSSPromoterAtU6.1c1 promoter (nonfunctional)Available SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-20
Plasmid#246303PurposeEvaluation of MtU6.6-189 promoter (Pol III promoter) deletion (189 bp) for CRISPR-Cas9 editing of mEGFP in Nicotiana benthamiana and poplar reporter linesDepositorInsertMtU6.6-189 promoter
UseCRISPRExpressionPlantPromoterMtU6.6-189 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
p305N-16
Plasmid#246299PurposeEvaluation of HbU6.2m1 promoter (Pol III promoter) sequence variation for CRISPR-Cas9 editing of mEGFP in a Nicotiana benthamiana reporter lineDepositorInsertHbU6.2m1 promoter
UseCRISPRExpressionPlantMutationA-to-G (-56 from TSS), C-to-T (-29), G-to-A (-24)PromoterHbU6.2m1 promoterAvailable SinceOct. 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1a-dCas9-VP64
Plasmid#235595PurposeExpresses the dCas9-VP64 under the control of human EF1a promoterDepositorInsertdCas9-VP64
UseCRISPRTagsNLSExpressionMammalianPromoterEF1aAvailable SinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT02
Plasmid#223374PurposeT-DNA vector for SpCas9 mediated mutagenesis for plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by AtU3 promoter; BASTA for plants selection.DepositorInsertZmUbi-SpCas9-AtU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT04
Plasmid#223376PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by OsU3 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-OsU3-gRNA scaffold
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pYPQAT06
Plasmid#223378PurposeT-DNA vector for SpCas9 mediated mutagenesis for monocot plants; NGG PAM; Cas9 was driven by ZmUbi1 and the sgRNA was driven by ZmUbi1 promoter; Hygromycin for plants selection.DepositorInsertZmUbi-SpCas9-ZmUbi-gRNA scaffold-tRNA
UseCRISPRTags3x FLAG and NLSExpressionPlantAvailable SinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5h
Plasmid#160295PurposeYeast CRISPR plasmid targeting the hphMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting hph: GACCTGATGCAGCTCTCGGA)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5n
Plasmid#160296PurposeYeast CRISPR plasmid targeting the natMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting nat: GTACCGCACCAGTGTCCCGG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCY5k
Plasmid#160294PurposeYeast CRISPR plasmid targeting the kanMX cassetteDepositorInsertssgRNA expression cassette (with guide targeting kan: TGTTTTGCCGGGGATCGCAG)
URA3 selection cassette
sgRNA expression cassette (without guide)
Cas9
UseCRISPRTags8xHis-tag and SV40 NLSAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCas9-EcRT-Z3-Nat
Plasmid#232094PurposeYeast CEN plasmid for estradiol-inducible expression of spCas9 and Ec86 reverse transcriptase.DepositorInsertZ3 promoter and Z3EV transcription factor
UseCRISPRExpressionYeastPromoterZ3Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDM028
Plasmid#216809PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and hph selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDM030
Plasmid#216810PurposeVector for Aspergillus CRISPR-Cas9 genetic engineering with Golden Gate cloning drop-out cassette for protospacer insertion and ble selectable marker.DepositorTypeEmpty backboneUseCRISPR; Fungal expressionExpressionBacterialAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRhaCAST
Plasmid#211791PurposepZLrhaB2plus with Sh-cas12K-tnsBC-tniQ cloned into, which drives by the rhamnose inducible promoterDepositorInsertShTnsB, ShTnsC, ShTniQ, ShCas12k, sgRNA scaffold for guide cloning
UseCRISPRExpressionBacterialPromoterRhamnose-inducibleAvailable SinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF823_EFS-Cas9-P2A-Puro
Plasmid#211645PurposeEFS-Cas9-P2A-PuroDepositorInsertCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCF226_EFS-Cas9-P2A-Puro
Plasmid#211644PurposeEFS-Cas9-P2A-PuroDepositorInsertCas9
UseCRISPR and LentiviralExpressionMammalianAvailable SinceFeb. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDL28_Cas9-His Δcys E532C/E1207C
Plasmid#206289PurposeBacterial expression of SpCas9 Δcys E532C and E1027C variant under T7 promoterDepositorInsertSpCas9
UseCRISPRTags6x-His and SV40 NLSExpressionBacterialMutationC80S, E532C, C574S, E1207CPromoterT7Available SinceSept. 20, 2023AvailabilityAcademic Institutions and Nonprofits only