We narrowed to 14,321 results for: cas9
-
Plasmid#160559PurposetRNA and scaffold 2.1scRNA aptamer Ms2 for the assembly of GBoligomers for the first position (positon [M2_3]) of a polycistronic tRNA-gRNA regulated by the U6-26 or U6-1 promoterDepositorInsertM2_3-pTRNA-scf 2.1
UseCRISPRMutationBsaI and BsmBI sites removedAvailable sinceFeb. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_2_Lb
Plasmid#155054PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLCHKO_HPRT1_exon3_1_Lb
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralExpressionMammalianPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
pGEL065
Plasmid#124896PurposeFor genome editing in plant by SpCas9 variant(SpCas9-NGv1)DepositorTypeEmpty backboneUseCRISPRExpressionPlantAvailable sinceJan. 9, 2020AvailabilityAcademic Institutions and Nonprofits only -
PB-iRFP-STOP-ReNL
Plasmid#113965PurposePiggybac transposon plasmid CRISPR gene deletion activatable fluorescence. Constitutive iRFP670 under EF1A promoter, CMV promoter with two SV40 polyA followed by red-enhanced nanolantern (ReNL)DepositorInsertsiRFP670
ReNL
UsePiggybac transposonExpressionMammalianPromoterCMV - SV40-PolyA - SV40-PolyA and EF1AAvailable sinceDec. 9, 2019AvailabilityAcademic Institutions and Nonprofits only -
PB-BE3-3NLS
Plasmid#119032PurposeStably express BE3 in mammalian cellsDepositorInsertBE3
Tags3xFlagExpressionMammalianAvailable sinceJan. 24, 2019AvailabilityAcademic Institutions and Nonprofits only -
Lenti CGIP + M-AAT target
Plasmid#86008Purposelenti reporter plasmid with M-AAT-specific gRNA target-sequence, to be used with tGFP #26864DepositorInsertsCAG promoter
M-AAT target
UseLentiviralMutationV30MAvailable sinceFeb. 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCfB3036(XI-1 MarkerFree)
Plasmid#73274PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XI-1 (Chr XI: 67491..68573)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCfB3037(XI-5 MarkerFree)
Plasmid#73277PurposeEasyClone-MarkerFree backbone vector for the addition of 1 or 2 genes and promoters for integration into site XI-5 (Chr XI: 11779..118967)DepositorTypeEmpty backboneUseCRISPR and Synthetic BiologyExpressionYeastAvailable sinceNov. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
AAV_3xgRNA;PTENA, p53B,SMAD4A_CAG_FlPO_synthPA
Plasmid#68346PurposeUsed to produce AAV expressing the FlpO recombinase and pig gRNA towards 3 tumor suppressors: PTEN, p53 and SMAD4DepositorInserts3xgRNA;PTENA, p53B,SMAD4A
FlPO
UseAAV; Flp/frtExpressionMammalianPromoterCAG and U6Available sinceDec. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
Reckleen_3plus_sgRNA_ptet_pos5a1
Plasmid#233462PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a1, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a1, ColE1 ori, and KanR.
UseCRISPRAvailable sinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5a2
Plasmid#233463PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a2, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5a2, ColE1 ori, and KanR.
UseCRISPRAvailable sinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b1
Plasmid#233465PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b1, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b1, ColE1 ori, and KanR.
UseCRISPRAvailable sinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
Reckleen_3plus_sgRNA_ptet_pos5b2
Plasmid#233466PurposeLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b2, for building RECKLEEN plasmid with multiple sgRNAsDepositorInsertLevel 1 part, Ptet sfgfp dropout sgRNA for position 5b2, ColE1 ori, and KanR.
UseCRISPRAvailable sinceApril 24, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pCRISPEY-Z3-Kan
Plasmid#232102PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceFeb. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCRISPEY-Z3-Hyg
Plasmid#232101PurposeYeast CEN plasmid for estradiol-inducible expression of CRISPR guide RNA and repair template for homologous recombination, with Z3 promoter and Z3EV transcription factor.DepositorTypeEmpty backboneUseCRISPRExpressionYeastAvailable sinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pDM070
Plasmid#216816PurposeAspergillus nidulans codon-adjusted mCardinal fluorescent protein, includes linker for C-terminal tagging.DepositorInsertmCardinal
TagsVinnyLinkerExpressionBacterialMutationAspergillus nidulans codon-adjustedAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDM097
Plasmid#216819PurposeAspergillus nidulans codon-adjusted mStayGold fluorescent protein, includes linker for N-terminal or internal tagging.DepositorInsertmStayGold
TagsFLAG-(SGGS)x2-XTEN16-(GGGGS)x3 and c4-(GGGGS)x2-X…ExpressionBacterialMutationAspergillus nidulans codon-adjustedAvailable sinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available sinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only