We narrowed to 25,058 results for: cas9
-
Plasmid#183430PurposeCreOFF knock-in for GluA1-GFP (amino acid position: stop codon)DepositorInsertgRNA and GFP donor
UseCRISPRAvailable SinceApril 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMC0x_gRNA_Pos5b_Ptet
Plasmid#179338PurposegRNA Position Vector 5b, used to create multi gRNA NT-CRISPR plasmid with pST_119_LVL2 camDepositorInsertPtet gRNA with sfGFP dropout
UseCRISPRAvailable SinceMarch 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMC0x_gRNA_Pos5a_Ptet
Plasmid#179337PurposegRNA Position Vector 5a, used to create multi gRNA NT-CRISPR plasmid with pST_119_LVL2 camDepositorInsertPtet gRNA with sfGFP dropout
UseCRISPRAvailable SinceMarch 21, 2022AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAC-U63-tgRNA-Gal80
Plasmid#169030PurposegRNA-marker vector contain a U6:3 promoter, gRNA scaffold, and a Ubi-Gal80 marker.DepositorTypeEmpty backboneUseCRISPRExpressionInsectPromoterU6:3Available SinceJune 10, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP1
Plasmid#113972PurposeSingle short guide RNA targeting GATCGAGTTCGAGCCTGCGG in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP2
Plasmid#113973PurposeSingle short guide RNA targeting GCGCGTTCTTTGGACGCGA in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
sgiRFP3
Plasmid#113974PurposeSingle short guide RNA targeting CGTGATGTTGTACCGCTTC in iRFP670 sequenceDepositorInsertiRFP670 sgRNA
UseCRISPRExpressionMammalianPromoterU6Available SinceMarch 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pRS423-ProSgH
Plasmid#163974PurposeHelper plasmid for cloning gRNAs under the control of the tRNA(Pro) promoterDepositorTypeEmpty backboneUseSynthetic BiologyExpressionYeastAvailable SinceFeb. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
sg1
Plasmid#113966PurposeSingle short guide RNA targeting GTATAGCATACATTATACGDepositorInsertsg1
PromoterU6Available SinceMay 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pYMCR2_Gb_PMLTSS
Plasmid#140285PurposeCRISPR/Cas9 plasmids encoding sgRNA targeting TSS of PML for knock-inDepositorInsertCas9
ExpressionMammalianPromoterCBHAvailable SinceMay 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS424-ysg(NT)
Plasmid#138258PurposeExpression of a non-targeting sgRNA to be used as a control in a yeast dual reporter systemDepositorInsertNontargeting sgRNA
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSB1C3-ysg(NT)
Plasmid#138263PurposeSubcloning and expression of non-targeting sgRNA for use in yeast dual reporter system.DepositorInsertNontargeting sgRNA
UseCRISPRExpressionYeastPromoterSNR52Available SinceMarch 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
PV521
Plasmid#132346PurposeCas9 R promoter targeting sgRNA1 expression cassette for Zea maysDepositorInsertCas9 R promoter targeting sgRNA1
ExpressionPlantAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PV523
Plasmid#132347PurposeCas9 R promoter targeting sgRNA2 expression cassette for Zea maysDepositorInsertCas9 R promoter targeting sgRNA2
ExpressionPlantAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
PV528
Plasmid#132348PurposeCas9 R promoter targeting sgRNA3 expression cassette for Zea maysDepositorInsertCas9 R promoter targeting sgRNA3
ExpressionPlantAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-mRuby-N
Plasmid#113752PurposeGateway multi-site entry clone for second position mRuby (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2
UseCRISPR; Gateway entry vectorTagsmRuby2Available SinceNov. 1, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmEGFP-N
Plasmid#113747PurposeGateway multi-site entry clone for second position 2x mEGFP (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags2xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-3xmEGFP-N
Plasmid#113748PurposeGateway multi-site entry clone for second position 3x mEGFP (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags3xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmEGFP-C
Plasmid#113750PurposeGateway multi-site entry clone for second position 2x mEGFP (C-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmEGFP-mEGFP
UseCRISPR; Gateway entry vectorTags2xmEGFPAvailable SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pENTR-R4R3-2xmRuby-N
Plasmid#113753PurposeGateway multi-site entry clone for second position 2x mRuby (N-terminal tag). Introduced into the genome via homology-directed repair after an LR reaction with homology sequences.DepositorInsertmRuby2-mRuby2
UseCRISPR; Gateway entry vectorTags2xmRuby2Available SinceSept. 24, 2018AvailabilityAcademic Institutions and Nonprofits only