We narrowed to 14,520 results for: SHR
-
Plasmid#232881PurposePlasmid expressing Cas9 and gRNA CCAAGTTCGACAACTGCGTA which targets the HIS3 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only
-
pML107-ADE13
Plasmid#232887PurposePlasmid expressing Cas9 and gRNA GTAGCAGCAAAAGAAGACAA which targets the ADE13 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-LAS17
Plasmid#232892PurposePlasmid expressing Cas9 and gRNA AATACCCTGAATTCTGCCGG which targets the LAS17 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
PE-pegRNA(BG)-nsgRNA(BG)
Plasmid#232727PurposeA dual-targeting vector that contains PE3 system guide RNAs against BFP (pegRNA(BG) and nsgRNA(BG)) with restriction enzyme sites for insertion of target site guide RNAS (pegRNAs(TS) and nsgRNA(TS)).DepositorInsertpegRNA(BG), nsgRNA(BG), pegRNAs(TS), nsgRNA(TS)
UseCRISPRExpressionMammalianPromoterU6Available SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#232883PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-INO80
Plasmid#232890PurposePlasmid expressing Cas9 and gRNA GGAAGTAGAATCATTCGTAG which targets the INO80 gene.DepositorAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri-U6-Camk2d sgRNA7
Plasmid#220127PurposeExpresses SauriABE8e by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoter, and add an HA tag fused to TadADepositorInsertMYL2, TadA, nSauriCas9
UseAAVTagsHA tagPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-inteinC-Sauri C aa439-1061-U6-Camk2d sgRNA7
Plasmid#220129PurposeExpresses Sauri cas9C by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, inteinC, nSauri Cas9C
UseAAV and CRISPRExpressionMammalianPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-TadA8e-SpN aa2-713- inteinN-U6-Camk2d sgRNA7
Plasmid#226915PurposeExpresses TadA8e and Sp cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSp Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-inteinC-SpC aa714-1368-U6-Camk2d sgRNA7
Plasmid#226916PurposeExpresses Sp cas9C by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, inteinC, nSp Cas9C
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-MYL2-HA-TadA8e-Sauri N aa1-438-inteinN-U6-Camk2d sgRNA7
Plasmid#226678PurposeExpresses TadA8e and Sauri cas9N by MYL2 promoter and sgRNA targeting murine Camk2d intron7 5' splice site by U6 promoterDepositorInsertMYL2, TadA, nSauri Cas9N, inteinN
UseAAVPromoterMYL2Available SinceJan. 16, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgCBS-1
Plasmid#230081PurposeCrispr knock out human CBS geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgCBS-2
Plasmid#230082PurposeCrispr knock out human CBS geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-1
Plasmid#230083PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-2
Plasmid#230084PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR v2-sgL2HGDH-3
Plasmid#230085PurposeCrispr knock out human L2HGDH geneDepositorAvailable SinceJan. 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCJ1023
Plasmid#228763PurposePlasmid expressing Cas9 and gRNAs for mouse Ift88 and Pkd2. Use for disruption of mouse Ift88 and Pkd2 in cultured cells.DepositorUseCRISPRTags3XFLAG and GFPExpressionMammalianPromoterhuman U6Available SinceDec. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgGFP
Plasmid#213165PurposeVector with sgGFP for induction of global DNA methylation.DepositorInsertsgGFP
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6 and PGKAvailable SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgAAVS1_145
Plasmid#213166PurposeVector with sgAAVS1 for induction of global DNA methylation.DepositorInsertsgAAVS1_145
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
SAM-DNMT3A+sgAAVS1_118
Plasmid#213167PurposeVector with sgAAVS1 for induction of global DNA methylation.DepositorInsertsgAAVS1_118
UseCRISPR, Lentiviral, and Synthetic BiologyExpressionMammalianPromoterE1Fa and U6Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only