180,114 results
-
Plasmid#211508PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-3-Phosphate (PI(3)P) from bacteriaDepositorAvailable sinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits onlyCited by
-
6xHis-SNAP-PI(3,5)P2 Probe
Plasmid#211512PurposeFor expression of recombinant biosensor for detection of Phosphatidylinositol-3,5-Bisphosphate (PI(3,5)P2) from bacteriaDepositorInsertSnxA-2xPX
Tags6xhis-SNAPExpressionBacterialAvailable sinceJan. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLIX403_RPS2_APOBEC_HA_P2A_mRuby_Capture1
Plasmid#194703PurposeInducible lentiviral expression, TRE-RPS2-APOBEC-HA-P2A-mRuby; PGK-puro-2A-rtTA (Ribo-STAMP, RPS2)DepositorInsertRPS2 (RPS2 Human)
UseLentiviralTagsAPOBEC1-HA-P2A-mRubyExpressionMammalianPromoterTRE promoter, Tet ONAvailable sinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pJRH-1345 U6-B2M sgRNA Gag-Cas9 v2
Plasmid#201916PurposeCas9-EDV production plasmid. Expresses the v2 Gag-Cas9 polypeptide (CAG promoter) and B2M sgRNA (human U6 promoter, 5’-GAGTAGCGCGAGCACAGCTA)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsGag-Cas9 v2
B2M sgRNA (Target-specific sequence: 5'- GAGTAGCGCGAGCACAGCTA)
ExpressionMammalianPromoterCAG and Human U6Available sinceAug. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBR322-Pdp1_NTD-Cre
Plasmid#198274PurposeFor loading Cre into PVCs; also contains PVC regulatory genesDepositorInsertPdp1_NTD-Cre
ExpressionBacterialAvailable sinceMarch 29, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pB80-hKif5b(1-560)rigor-2xmNeongreen
Plasmid#174649PurposeLive-cell marker for stable microtubulesDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInserthKif5B(1-560)rigor-2xmNeongreen (KIF5B Human)
TagsmNeongreen-mNeongreenExpressionMammalianMutationrigor mutation G234APromoterChicken beta-actinAvailable sinceMarch 7, 2023AvailabilityAcademic Institutions and Nonprofits onlyCited by -
AAV-mDlx-jGCaMP8m-WPRE (AAV9)
Viral prep#176754-AAV9PurposeReady-to-use AAV9 particles produced from AAV-mDlx-jGCaMP8m-WPRE (#176754). In addition to the viral particles, you will also receive purified AAV-mDlx-jGCaMP8m-WPRE plasmid DNA. mDlx enhancer-driven expression of calcium sensor GCaMP8m in GABA-ergic interneurons. These AAV preparations are suitable purity for injection into animals.DepositorPromotermDlxAvailable sinceFeb. 24, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDAC446
Plasmid#195239PurposeMammalian expression of Csm complex from separate promoters; GFP backbone (Used for RNA knockdown)DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertFLAG-NLS-Csm1; FLAG-NLS-Csm2; FLAG-NLS-Csm3; FLAG-NLS-Csm4; FLAG-NLS-Csm5; FLAG-NLS-Cas6; crRNA; GFP
ExpressionMammalianAvailable sinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pATetO 6XHis-Taq DNA Ligase
Plasmid#178798PurposeInducible expression of Taq DNA Ligase in E. coliDepositorInsertTaq DNA Ligase
ExpressionBacterialAvailable sinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
mito-meGFP
Plasmid#172481PurposemeGFP targeted to the mitochondrial matrix with a human COX8 presequenceDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertMito (COX8A Human)
TagsmeGFPExpressionMammalianPromoterCMVAvailable sinceOct. 14, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pAAV-Ef1a-mCherry (AAV Retrograde)
Viral prep#114470-AAVrgPurposeReady-to-use AAV Retrograde particles produced from pAAV-Ef1a-mCherry (#114470). In addition to the viral particles, you will also receive purified pAAV-Ef1a-mCherry plasmid DNA. EF1a-driven mCherry expression. These AAV were produced with a retrograde serotype, which permits retrograde access to projection neurons. These AAV preparations are suitable purity for injection into animals.DepositorPromoterEF1aTagsmCherryAvailable sinceSept. 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-S5E2-GCaMP6f (AAV PHP.eB)
Viral prep#135632-PHPeBPurposeReady-to-use AAV PHP.eB particles produced from pAAV-S5E2-GCaMP6f (#135632). In addition to the viral particles, you will also receive purified pAAV-S5E2-GCaMP6f plasmid DNA. Expression of GCaMP6f under the control of the E2 regulatory element. These AAV were produced with the PHPeB serotype, which permits efficient transduction of the central nervous system. These AAV preparations are suitable purity for injection into animals.DepositorAvailable sinceSept. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
G13-CASE
Plasmid#168127PurposeEncodes a BRET-based activity sensor for the heterotrimeric G protein G13. Composed of the subunits G alpha 13 (GNA13) tagged with NanoLuciferase, G beta 3 (GNB3) and Venus-tagged G gamma 9 (GNG9).DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAUseLuciferaseTagscpVenus on GNG9ExpressionMammalianMutationNLuc is inserted at F125/D126 within GNA13Available sinceJuly 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCAG-Synapto-pHluorin
Plasmid#168510PurposeExpression of Synapto-pHluorin for optical monitoring of presynaptic release in neurons.DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertSynaptophysin-pHluorin (Syp Mouse)
TagspHluorinExpressionMammalianPromoterCAGAvailable sinceApril 12, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-CreEGFP
Plasmid#165140PurposeExpression of Cre recombinase fused with EGFP in C-terminalDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertCre recombinase
TagsEGFPExpressionMammalianPromoterCMVAvailable sinceMarch 9, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GRAB_eCB2.0
Plasmid#164604PurposeExpress the endocannabinoid sensor GRAB_eCB2.0 in neuronsDepositorInsertEndocannabinoid sensor GRAB_eCB2.0
UseAAVMutationS383TPromoterhSynAvailable sinceFeb. 18, 2021AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pHAGE-NLS-dPguCas13b-3xmRuby3-NLS
Plasmid#132406Purposeoverexpression in human cellsDepositorInsertdPguCas13b
UseLentiviralExpressionMammalianMutationH151A; H1121AAvailable sinceAug. 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
M13KO7-ΔPS-ΔgeneIII
Plasmid#134351PurposeHelper phage for M13 phage productionDepositorInsertHelper phage gene
ExpressionBacterialAvailable sinceJune 11, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pLenti-DHB-mVenus-p2a-mCherry-CDK4KTR
Plasmid#126679PurposeFluorescent reporter for cyclin E/A-CDK and CDK4/6 activitiesDepositorInsertRb (a.a 886-928)
UseLentiviralTagsmCherryExpressionMammalianAvailable sinceApril 22, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by -
pBbAW4k-loxP-TT-loxP-mRFP1
Plasmid#134405PurposeFluorescent reporter for Cre recombinase activity. Cre removes a transcription terminator, leading to RFP production.DepositorInsertW4-loxP-TT-loxP-mRFP1
UseCre/Lox and Synthetic BiologyExpressionBacterialPromoterW4 (modified T7A1)Available sinceJan. 17, 2020AvailabilityAcademic Institutions and Nonprofits onlyCited by