We narrowed to 13,472 results for: sequence
-
Plasmid#128398PurposePeriplasmic expression of E. coli MBP with C terminal 4xDQNAT glycosylation sites in E. coliDepositorInsertMaltose binding protein
Tags4xDQNAT glycosylation tag, 6xHis tag, and DsbA si…ExpressionBacterialMutationY342H- please see depositor commentsPromotertrcAvailable SinceApril 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
Sema6b(S)-AP-His
Plasmid#72040PurposeExpresses the extracellular region of the Sema6B protein (truncated at extracellular domain cleavage site; ie, short), C-terminally fused to alkaline phosphatase + 6X histidine tag.DepositorAvailable SinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-TAPBPR-TM
Plasmid#178645PurposeMammalian expression of FLAG-tagged TAPBPR with MHC TMDepositorInsertTAPBPR (TAPBPL Human)
TagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationswitched transmembrane domain with that of MHC-IPromoterCMVAvailable SinceJuly 11, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HA-Flag-natT1R2 ECD-MHC
Plasmid#113957Purposemammalian expression plasmid for FLAG-tagged human T1R2 ECD with signal peptide of influenza hemagglutinin fused to a canonical transmembrane domain from MHC class IDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG, Signal/leader sequence from influenza hemag…ExpressionMammalianMutationresidues 22-568 fused to a transmembrane tetherPromotercmvAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
p5E-1.7kbfabp6
Plasmid#159087Purposep5E with promoter sequence 1.7kb upstream of zebrafish fabp6 geneDepositorInsert1.7kb fabp6 promoter (fabp6 Zebrafish)
UsePromoter fragment 5' entry vector for tol2 c…Promoter1.7kb fabp6Available SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
PB713B-pCMV-MITD-NeoMini-T2A-tCD19-WPRE
Plasmid#174610PurposePiggyBack transposon expressing a fusion of a tandem minigene antigens in KRAS, BRAF and CMV fused to an endosomal targeting sequence and translationally linked to human truncated CD19DepositorInserthuman CD19, antigen minigene
ExpressionMammalianAvailable SinceOct. 5, 2021AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hlbCas12a-Nlux
Plasmid#176240PurposepNOC episomal plasmid harboring the humanized lbCas12a gene sequence tagged with Nlux under the control of Ribi promoterDepositorInserthumanized lbCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferasePromoterRibosomal subunitAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
CCM2_wt_eGFP
Plasmid#208876PurposeExpress eGFP-CCM2 in mammalian cells.DepositorAvailable SinceDec. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
Sema7a-Fc-His
Plasmid#72175PurposeExpresses the extracellular region of the Sema7A protein, C-terminally fused to the Fc region of human IgG1 + 6X histidine tag.DepositorAvailable SinceFeb. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-rBrokenheart
Plasmid#203394PurposeAAV transfer plasmid containing a constitutive (non Cre-dependent) BrokenHeart construct: a piggyBac donor transposon interrupting tdTomato. Transposase activity rescues coding sequence.DepositorInsertBrokenheart
UseAAVExpressionMammalianPromoterEF1aAvailable SinceJuly 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1(+)-HLA-Flag-natT1R2
Plasmid#113947Purposemammalian expression plasmid for FLAG-tagged human T1R2 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R2 (TAS1R2 Human)
TagsFLAG and Signal/leader sequence from HLA class I …ExpressionMammalianMutationresidues 22-839Available SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-dSaCas9-NLS-3xHA-3xSunTag_bGHpA
Plasmid#177345PurposeAAV expression of a catalytically inactive SaCas9 (dSaCas9) fused with three copies of SunTag sequence from Synapsin promoterDepositorInsertdead hSaCas9
UseAAV and CRISPRTags3x GCN4 peptide, 3xHA, and NLSExpressionMammalianMutationD10A, N580APromoterSynapsinAvailable SinceSept. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pENTR-DMD-Donor
Plasmid#60605PurposeKnock-in donor vector to insert Exon 44 in front of Exon 45 of human DYSTROPHIN (DMD)gene, include EF1a-hygromycin resistance cassette flanked by loxP sequences.DepositorInsertHygromycin resistant gene
UseKnock-in donor vectorExpressionMammalianAvailable SinceDec. 15, 2014AvailabilityAcademic Institutions and Nonprofits only -
Chicken ArcLight A173
Plasmid#53615PurposeGenetically encoded voltage sensor ArcLight with improved kineticsDepositorInsertChicken ArcLight-A173
ExpressionMammalianMutationGg-VSP contains an R153Q mutation and an amino ac…PromoterCMVAvailable SinceAug. 7, 2014AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_NR1_NR2_LPT1
Plasmid#176253PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and CRISPR array with spacers 1 and 2 targeting the Nitrate reductase gene and one spacer targeting the LPAAT geneDepositorInserthumanized fnCas12a
UseCRISPR, Luciferase, and Synthetic Biology ; Expre…TagsluciferaseAvailable SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
pJZC33
Plasmid#62330PurposesgRNA + 2x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 2x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-plus
Plasmid#126767PurposeExpression plasmid for human codon-optimized increased fidelity eSpCas9-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9.DepositorInserteSpCas9-plus
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A, R1060A; amino acids 1005-1013 replaced wit…PromoterCBhAvailable SinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-HLA-cmyc-optiT1R3 a21-852
Plasmid#113948Purposemammalian expression plasmid for c-myc-tagged human codon-optimized human T1R3 with signal peptide of HLA class I histocompatibility antigen A-2 alpha chainDepositorInsertT1R3 (TAS1R3 Human)
TagsSignal/leader sequence from HLA class I histocomp…ExpressionMammalianMutationresidues 21-852PromoterCMVAvailable SinceFeb. 8, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCEP4-BG505.SOSIP-QES.i03.c01-8his
Plasmid#111846PurposeMammalian expression plasmid for soluble BG505 SOSIP.664; QES mutant with enhanced binding to PG16DepositorInsertHIV-1 Env (BG505 SOSIP.664)
Tags8his purification tag and CD5 leader sequenceExpressionMammalianMutationCodon-optimized synthetic gene; has SOSIP mutatio…PromoterCMVAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
p2R3a-3AT
Plasmid#71273PurposeEntry clone containing 3AT. Necessary to complete the transcriptional reporters by providing the poly-A tail. For use in plants and compatible with the MultiSite Gateway systemDepositorInsertT3A ribulose-1,5-bisphosphate carboxylase 3A subunit terminator
UseGatewayAvailable SinceDec. 7, 2015AvailabilityAcademic Institutions and Nonprofits only