We narrowed to 26,086 results for: cas9 genes
-
Plasmid#48654PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TB
Plasmid#48652PurposeBacterial NM crRNA expression: targets NM to protospacer B (ACTTTAAAAGTATTCGCCAT), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer B
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-SP!TA
Plasmid#48649PurposeBacterial SP crRNA expression: targets SP to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial SP crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-ST1-B
Plasmid#48662PurposeBacterial ST1 repression YFP reporter: protospacer BDepositorInsertST1 prototspacer B/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-ST1!TA
Plasmid#48653PurposeBacterial ST1 crRNA expression: targets ST1 to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial ST1 crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pMLS1272
Plasmid#188891PurposeRic-4 sgRNA expression vectorDepositorInsertPU6(R07E5.16)::Ric-4 sgRNA (CELE_Y22F5A.3 Nematode)
ExpressionWormAvailable SinceAug. 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMLS715
Plasmid#188887PurposeMultisite Gateway [4-3] Destination vector; lox2272-flanked Cbr-unc-119 marker; homology to 5' miniMos ArmDepositorTypeEmpty backboneUseMultisite gateway [4-3] destination vectorAvailable SinceAug. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
PV384
Plasmid#132344PurposeCas9 DsRed targeting sgRNA expression cassette for Zea maysDepositorInsertCas9 DsRed targeting sgRNA
ExpressionPlantAvailable SinceOct. 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCAS_gpyrG2
Plasmid#90277Purpose(also pMST620-BB3_gpyrG2_cas9) CRISPR/Cas9 plasmid with gRNA for site pyrG2, Cas9DepositorInsertgRNA (pyrg2)
UseA. nigerExpressionBacterialAvailable SinceDec. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-NM-A
Plasmid#48664PurposeBacterial NM repression YFP reporter: protospacer ADepositorInsertNM prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
SK-YFP-TD-A
Plasmid#48666PurposeBacterial TD repression YFP reporter: protospacer ADepositorInsertTD prototspacer A/PAM with reporter EYFP
UseCRISPRPromoterlambda pR promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pRC319
Plasmid#61272PurposeAlso referred to as pΦRGNndm-1. Expresses Cas9, tracrRNA and a guide RNA targeting the NDM-1 gene. Contains a ColE1 origin, kanamycin resistance cassette and f1 origin for packaging in M13 particles.DepositorInsertCas9, tracrRNA, crRNA
UseCRISPRTags6xHisExpressionBacterialAvailable SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
peft-3::cas-9::tbb-2 3'UTR
Plasmid#48960Purposethis plasmid contains the codon optimized gene encoding Cas9 for C. elegans.DepositorInsertcas9
UseCRISPRPromotereef-1A.1 (eft-3)Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCfB8792
Plasmid#126910PurposeTemplate for PCR amplification of ADE2 gRNA biobrick for targeting Saccharomyces cerevisiae ADE2 geneDepositorInsertADE2 gRNA
UseSynthetic BiologyAvailable SinceDec. 17, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#1
Plasmid#64245Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6b:sgRNA#3
Plasmid#64247Purposeexpresses sgRNA under U6b promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6a:sgRNA#2
Plasmid#64246Purposeexpresses sgRNA under U6a promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 7, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6c:sgRNA#4
Plasmid#64248Purposeexpresses sgRNA under U6c promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pU6d:sgRNA#5
Plasmid#64249Purposeexpresses sgRNA under U6d promoterDepositorTypeEmpty backboneUseCRISPRAvailable SinceMay 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJA58
Plasmid#59933PurposegRNA for cleavage at dpy-10(cn64) locus in C elegansDepositorInsertdpy-10(cn64) gRNA
UseCRISPRPromoterU6Available SinceSept. 22, 2014AvailabilityAcademic Institutions and Nonprofits only