We narrowed to 15,929 results for: grna
-
Plasmid#99896PurposeExpress single gRNA with gRNA2.0 scaffold (with four MS2 binding sites) under AtU6 promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterAtU6Available SinceMarch 8, 2018AvailabilityAcademic Institutions and Nonprofits only
-
EE-SP!gIII
Plasmid#48667PurposeBacterial SP Cas9 targeting filamentous phage gene III at five protospacersDepositorInsertsCas9
anti-gIII tracrRNA
UseCRISPRPromoterproC and tracrRNA promoterAvailable SinceOct. 28, 2013AvailabilityAcademic Institutions and Nonprofits only -
PM-NM!TA
Plasmid#48651PurposeBacterial NM crRNA expression: targets NM to protospacer A (TACCATCTCAAGCTTGTTGA), p15A/chloramphenicolDepositorInsertBacterial NM crRNA to prototspacer A
UseCRISPRPromoterJ23100 promoterAvailable SinceOct. 17, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCG-ACTB-C4
Plasmid#229846PurposeExpresses wild-type Cas9 and gRNA for ACTB gene.DepositorInsertguide RNA for ACTB gene
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
AWP-029
Plasmid#213966PurposeExpresses dPb2Cas12a under an IPTG-inducible promoter and contains a cassette for gRNA constitutive expression.DepositorInsertCas12a (cas12a Segatella bryantii, Synthetic)
Tags3XFLAGExpressionBacterialMutationD875A to inactivate target nuclease activityPromoterPcfxA, IPTG inducibleAvailable SinceApril 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
pYPQ134-tRNA
Plasmid#179213PurposeGolden Gate entry vector; 4th gRNA with tRNADepositorTypeEmpty backboneUseCRISPRPromoterno promoterAvailable SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
5aa SunTag VP64 EVD
Plasmid#115483PurposeCRISPR-Cas9 SunTag system to target VP64 to the EVD/ATR loci each with two guide RNAsDepositorInsertg2_U6_g1_U6_NOS_NLS_GB1_NLS_linker_VP64_linker_sfGFP_scFv_UBQ10_Insulator_UBQ10_Ω_dCas9_1xHA_2xNLS_linker_10xGCN4_OCS
UseCRISPR and Synthetic BiologyExpressionPlantAvailable SinceMarch 25, 2019AvailabilityAcademic Institutions and Nonprofits only -
pPN062
Plasmid#91595PurposeExpress sgRNA targeting human DFNA5DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPN063
Plasmid#91596PurposeExpress sgRNA targeting human DFNA5DepositorAvailable SinceOct. 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pJZC523
Plasmid#62320PurposesgRNA for yeast cellsDepositorInsertsgRNA
ExpressionYeastPromoterSNR52Available SinceMay 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pJZC25
Plasmid#62328PurposesgRNA + 1x MS2 with MCP-VP64 effector for mammalian cellsDepositorInsertssgRNA + 1x MS2 binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets Tet3G, sequence: GTACGTTCTCTATCACTGATAPromoterCMV and U6Available SinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pUC57kan-T7-mt-gRNA library
Pooled Library#82480PurposeThis library is intended to be used as a technical tool for removal of mitochondrial DNA from mouse genomic DNA preparations.DepositorAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLenti CRISPR sgMTHFD2_1
Plasmid#106313PurposeExpress Cas9 and sgRNA targeting MTHFD2DepositorAvailable SinceApril 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
pPN10
Plasmid#114386PurposeEmpty gRNADepositorTypeEmpty backboneUseCRISPRAvailable SinceAug. 15, 2023AvailabilityAcademic Institutions and Nonprofits only -
pYPQ135-tRNA2.0
Plasmid#158397PurposeGolden Gate entry vector to express the 5th gRNA with tRNA2.0 scaffold (with four MS2 binding sites) without promoterDepositorTypeEmpty backboneUseCRISPRExpressionPlantPromoterWithout promoterAvailable SinceJune 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
-
1197TCC_gZBF-HG
Plasmid#241826PurposepgSIT 2.0 gRNA expressing plasmid with working HR5Ie1-EGFP SEPARATOR cassetteDepositorInsertActin5C promoter
UseCRISPRExpressionInsectAvailable SinceOct. 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCG-NT2
Plasmid#229848PurposeExpresses wild-type Cas9 and gRNA with non-target sequence.DepositorInsertguide RNA with non-target sequence
UseCRISPRExpressionMammalianAvailable SinceJan. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
C114m
Plasmid#121013PurposeMoClo golden gate assembly CD part for Cas9 (S. pyogenes gRNA-targeted endonuclease Cas9, with bbsI cut sites removed synonymously). Please see Supplemental Documents for annotated Genbank file.DepositorInsertdCas9 with no bbsI or BsaI sites
UseSynthetic BiologyAvailable SinceDec. 4, 2019AvailabilityAcademic Institutions and Nonprofits only -