We narrowed to 12,237 results for: nsf
-
Plasmid#221619PurposeA recombinant AAV2 plasmid encoding the ZipACR I151T mutant with soma targeting with KV2.1 motif and membrane expression enhanced vfChrimson-Citrine with soma targeting KV2.1 motif.DepositorInsertZipACR (I151V)KV2.1-2A-IvfChr-citrine-Kv2.1
UseAAVMutationZipACR (I151T) with soma targeting, vfChrimson w…PromoterHuman SynapsinAvailable SinceAug. 14, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipT-2A-IvfChr (mCherry, KV2.1)
Plasmid#221621PurposeA recombinant AAV2 plasmid encoding the ZipACR I151T mutant with soma targeting with KV2.1 motif and membrane expression enhanced vfChrimson-mCHerry with soma targeting KV2.1 motif.DepositorInsertZipACR (I151V)KV2.1-2A-IvfChr-mCherry-Kv2.1
UseAAVMutationZipACR (I151T) with soma targeting, vfChrimson w…PromoterHuman SynapsinAvailable SinceAug. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV-hSyn-ZipV-2A-IvfChr (citrine, KV2.1)
Plasmid#221618PurposeA recombinant AAV2 plasmid encoding the ZipACR I151V mutant with soma targeting with KV2.1 motif and membrane expression enhanced vfChrimson-Citrine with soma targeting KV2.1 motif.DepositorInsertZipACR (I151V)KV2.1-2A-IvfChr-citrine-Kv2.1
UseAAVMutationZipACR (I151V) with soma targeting, vfChrimson w…PromoterHuman SynapsinAvailable SinceAug. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-miRFP670
Plasmid#220600PurposeConstitutive expression of a single-cell discriminating version of miRFP670 fluorescent protein.DepositorInsertmiRFP670
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceAug. 1, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-mVenus-Q69M(ME)
Plasmid#220597PurposeConstitutive expression of a single-cell discriminating version of mVenus-Q69M (ME) fluorescent protein.DepositorInsertmVenus-Q69M (ME)
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-ArgiNLS-mKate2
Plasmid#220599PurposeConstitutive expression of a single-cell discriminating version of mKate2 fluorescent protein.DepositorInsertmKate2
UseAAVTagsArgiNLSExpressionMammalianPromoterEF1aAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-FLEX-ArgiNLS-EGFP
Plasmid#220601PurposeCre-dependent expression of a single-cell discriminating version of EGFP fluorescent proteinDepositorInsertEGFP
UseAAV and Cre/LoxTagsArgiNLSExpressionMammalianPromoterCAGAvailable SinceJuly 31, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552 EF1a DIO Chronos GFP_VgatTTT gRNA
Plasmid#215278PurposeExpresses Vgat Control gRNA in a Cre dependent Chronos GFP vectorDepositorInsertVgat control gRNA
UseAAVExpressionMammalianPromoterU6Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pX552-hSyn-DIO-GCaMP8f_Grin1 gRNA
Plasmid#215281PurposeExpresses Grin 1 gRNA in a Cre dependent GCaMP8f vectorDepositorInsertGrin1 gRNA
UseAAVExpressionMammalianMutationSee Depositor Comments BelowPromoterU6Available SinceJuly 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G12-hFGF1
Plasmid#219554PurposehFGF1 expression in mammalian cells. pAAV vector. Reporter plasmid.DepositorInserthFGF1 (FGF1 Human)
UseAAVExpressionMammalianPromoter12xUAS with TATA-box minimal promoterAvailable SinceMay 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJT310 AAV-BFPdonor
Plasmid#202057PurposeAAV HDR donorDepositorInsertAAV-BFPdonor
UseAAV; Aav packaging plasmidExpressionMammalianMutationITR deletionAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AAV2_CAG_oROS-G_LF(C199S)
Plasmid#216116PurposeEncodes the loss-of-function mutation C199S of the genetically encoded, green fluorescent peroxide sensor oROS-G in AAV viral vectors.DepositorInsertoROS-G_LF(C199S)
UseAAVExpressionMammalianPromoterCAGAvailable SinceApril 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV_MSX1-FKBP-mNeonGreen-V5
Plasmid#215025PurposeAAV vector for knocking in a C-terminal tag (FKBP12F36V, mNeonGreen, and V5) for human MSX1DepositorAvailable SinceMarch 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-Synapsin-SspB-EGFP-VP16-P2A-FLAG-TetR-NLS-CapN-SsrA-CapC
Plasmid#213535PurposeExpresses the split transcription factors in cultured neuron and mouse brainDepositorInsertSspB-EGFP-VP16-P2A-FLAG-TetR-NLS-CapN-SsrA-CapC-HA-HA
UseAAVTagsEGFP and HAExpressionMammalianPromoterSynapsinAvailable SinceFeb. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CASI-InteinC-SpG C aa714-1368-U6-Lmna sgRNA1
Plasmid#208110PurposeExpresses SpG cas9C by the constitutive CASI promoter and sgRNA targeting murine Lmna c.1621T mutation by U6 promoterDepositorInsertSpG C, U6, Lmna sgRNA1, scaffold
UseAAVPromoterU6Available SinceFeb. 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(AAVS1)-PGKpuro2ABFP-W
Plasmid#200459PurposeLentiviral vector expressing gRNA targeting human AAVS1DepositorInsertAAVS1 (AAVS1 Human)
UseLentiviralAvailable SinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEJS-HZ08-pAAVsc.U6-tracrRNA
Plasmid#211816PurposeAAV vector expressing tracrRNA under U6 promoterDepositorInsertU6-tracrRNA
UseAAVExpressionMammalianPromoterU6Available SinceJan. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCOA-Leu-FvPPT1
Plasmid#179923PurposeExpression vector for heterologous expression of a polyketide synthase in S. cerevisiae. Carries and empty insertion site and the Fusarium verticillioides 4´-phosphopantetheinyltransferase PPT1DepositorInsertFvPPT1
ExpressionYeastMutationCodon optimized for expression in Saccharomyces c…PromoterYarrowia lipolytica EXP1Available SinceNov. 29, 2023AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Solo-sTagRFP-TUBA1B
Plasmid#207765PurposeDonor template for sTagRFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a sTagRFP Tag (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits