We narrowed to 29,278 results for: tat
-
Plasmid#239120PurposehACOD1 with M154I mutation in mammalian expression vectorDepositorInsertcis-aconitate decarboxylase (ACOD1 Human)
TagsMyc and FLAGExpressionMammalianMutationM154IPromoterCMVAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMT-Myc-BirA*G3-ER
Plasmid#240234PurposeExpression of ER-localized Myc-BirA*-G3 under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertBiP-Myc-BirA*G3-KDEL
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pENTR_CG6867_nostop
Plasmid#240238PurposeGateway entry clone with CG6867 without stop codonDepositorInsertCG6867 (CG6867 Fly)
UseGateway shuttle vectorAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHAGE2-TetO-SOX17WT
Plasmid#216176PurposeGenerate lentiviruses encoding for wild-type SOX17DepositorInsertSOX17 (SOX17 Human)
UseLentiviralMutationGlu113Glu (silent mutation); Glu120Glu (silent mu…Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pRRL-SFFV_V5-CHIC2-C6S_Tomato
Plasmid#238128PurposeExpresses V5-tagged CHIC2 (with C6S mutation) with Tomato selectable marker.DepositorInsertV5-tagged CHIC2 with C6S mutation
TagsV5ExpressionMammalianMutationChanged cysteines from amino acids 102-109 to ser…PromoterSFFVAvailable SinceJuly 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGEMHE-MmBorealin-OLLAS
Plasmid#237439PurposeExpresses mouse Borealin tagged with OLLAS at C-term; made for in vitro transcription (T7 promoter)DepositorAvailable SinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-73kb-DSF
Plasmid#227499Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 73kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-4mer-35kb-DSF
Plasmid#227491Purpose4-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 35kb Downstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-7.1kb-USF
Plasmid#227474Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 7.1kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-3.3kb-USP
Plasmid#227450Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 3.3kb Upstream Prdm8
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-58kb-USF
Plasmid#227457Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 58kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-40kb-USF
Plasmid#227460Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 40kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-36kb-USF
Plasmid#227461Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-5mer-36kb-USF
Plasmid#227462Purpose5-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 36kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pk335-CARGO-6mer-33kb-USF
Plasmid#227465Purpose6-mer gRNA array targeting Sp dCas9/Cas9 to the Prdm8-Fgf5 locusDepositorInsertCARGO to 33kb Upstream Fgf5
UseCRISPRAvailable SinceMay 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-VRG4
Plasmid#232899PurposePlasmid expressing Cas9 and gRNA TCGCATAGCCCAGTATACGT which targets the VRG4 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pJExpress401-KDAC8 D101N
Plasmid#224348PurposeExpresses human KDAC8 (HDAC8) D101N in E. coliDepositorInsertKDAC8 (HDAC8 Human)
TagsTEV-cleavable His6ExpressionBacterialMutationAspartate 101 mutated to asparaginePromoterT5Available SinceFeb. 19, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pGL3_5UTR_Myc_FLuc Compensatory Mutant
Plasmid#229504PurposeMyc 5' untranslated region firefly luciferase reporter with compensatory mutations in the region bound by RBM42DepositorInsertMyc 5'UTR_CompMutant
ExpressionMammalianMutationMutations in bp 363-394PromoterSV40Available SinceFeb. 12, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPB758
Plasmid#210033PurposeContains inducible Cas7-P2A-Cas5-T2A-Cas8, rtTA-T2A-puroDepositorInsertsCas7-P2A-Cas5-T2A-Cas8
rtta-T2A-puro
UseCRISPRTagsSV40 NLSExpressionMammalianPromoterEF-1α and TRE3GAvailable SinceFeb. 6, 2025AvailabilityAcademic Institutions and Nonprofits only