We narrowed to 10,190 results for: yeast
-
Plasmid#118586PurposeFor use as a positive control for translation of the Rluc gene in the transfected cells and negative control for replication.DepositorInsertDENV4 Renilla luciferase gene (Rluc) reporter replicon containing replication-defective GND mutation in the NS5 polymerase gene.
UseYeast-e. col shuttle vector prs424MutationThe conserved GDD in the NS5 polymerase gene muta…Available SinceAug. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-RDS1a
Plasmid#87405Purposep426_Cas9_gRNA-RDS1a without the ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting RDS1a sequence ATTCAATACGAAATGTGTGC in yeast chromosome 3.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting RDS1a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pAG416GALL-HIV-1_PR
Plasmid#203493PurposeExpresses HIV-1 protease from a GALL promoter with a URA3 markerDepositorInsertHIV-1 protease
ExpressionYeastPromoterGALLAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAGE2.0
Plasmid#165984PurposeMulti-host shuttle vector that can be transferred by conjugation and replicate in S. meliloti, E. coli, S. cerevisiae, and P. tricornutum. Contains S. meliloti pSymA origin and Tet resistance.DepositorInsertsRK2/RP4 origin of transfer
repA2B2C2
nourseothricin N-acetyl transferase
tetracycline resistance
UseSynthetic Biology; Bacterial and yeast cloning; c…Available SinceOct. 27, 2022AvailabilityAcademic Institutions and Nonprofits only -
pBKWH-Lam
Plasmid#133899PurposeNegative control. Expression of Gal4BD-Lam hybrid protein. Homology regions for recombination with pAWHDepositorAvailable SinceJune 11, 2020AvailabilityAcademic Institutions and Nonprofits only -
pPICZ:mTREK-1_cryst
Plasmid#133269PurposeP. pastoris expression vector. It will generate the mouse TREK-1 channel (21-322) fused to a C-terminal GFPDepositorInsertPotassium channel subfamily K member 2 (KCNK2, TREK-1) (Kcnk2 Mouse)
TagsSNS- 3C_cleavage_site-TAAA-GFPExpressionYeastMutationaa 21-322, K84R, Q85E, T86K, I88L, A89R, Q90A, A9…Available SinceApril 17, 2020AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS607c
Plasmid#87409Purposep426_Cas9_gRNA-ARS607c without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS607c sequence CTATTTTTGCTTTCTGCACA in yeast chromosome 6.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS607c
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pCHKU34.1-2.2
Plasmid#115534PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
ExpressionYeastAvailable SinceMarch 5, 2019AvailabilityAcademic Institutions and Nonprofits only -
pYO391
Plasmid#235751PurposeProtein expression of ScVPS38, untagged + ScVPS34, untagged + FL ScVPS15-ZZ + ZZ-FL ScVPS30DepositorInsertsTags3xTEV-ZZ and ZZ-3xTEVExpressionYeastMutationS2A and T134A, I851RPromoterGALGAPDHAvailable SinceOct. 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar2
Plasmid#232739PurposeExpresses NADPH/NADP+ biosensor NAPstar2 in S. cerevisiae.DepositorInsertNAPstar2
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar4
Plasmid#232741PurposeExpresses NADPH/NADP+ biosensor NAPstar4 in S. cerevisiae.DepositorInsertNAPstar4
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar6
Plasmid#232742PurposeExpresses NADPH/NADP+ biosensor NAPstar6 in S. cerevisiae.DepositorInsertNAPstar6
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
p413 TEF NAPstar7
Plasmid#232744PurposeExpresses NADPH/NADP+ biosensor NAPstar7 in S. cerevisiae.DepositorInsertNAPstar7
ExpressionYeastAvailable SinceApril 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pPICZ A-SLC-His+MFN2-Strep (SB255)
Plasmid#227604PurposeInducible coexpression of His-tagged SLC25A46 and Strep-tagged MFN2 in Pichia pastorisDepositorTags10xHis and Twin-StrepTagExpressionYeastPromoterAOX1Available SinceDec. 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRHD-TetR-GAL80-Rho1-GAL4
Plasmid#218274PurposeIntroduction of low-temperature-inducible GAL system, LowTempGAL v2.2DepositorInsertgal80Arm1-pAgTEF1>KanMX4>tAgTEF1-pHAC1>UBI4>>DHFRP66L-TetR>NLS>TUP1>tABF1-pTEF2>Rho1C17R>>GAL4>tGAL4-pTEF1(TetO)>GAL80Arm2
ExpressionYeastMutationDHFR (P66L), Rho1 (C17R)Available SinceMay 24, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRHDGAL43C
Plasmid#218279PurposeIntroduction of a LowTempGAL Turbo module (HD-GAL43C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pNRG2>GAL4>tNRG2-PENO2> UBI4>RHGSGTMV>DHFRP66L>G*6>GAL3C(S509P)-tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P), DHFR (P66L)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRGAL43C
Plasmid#218278PurposeIntroduction of a LowTempGAL Turbo module (GAL43C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pNRG2>GAL4>tNRG2-pENO2>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRHDGAL3C
Plasmid#218276PurposeIntroduction of a LowTempGAL Turbo module (HD-GAL3C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pENO2> UBI4>RHGSGTMV>DHFRP66L>G*6>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P), DHFR (P66L)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIRGAL3C
Plasmid#218275PurposeIntroduction of a LowTempGAL Turbo module (GAL3C) to accelerate induction of GAL promoter inductionDepositorInsertfcy1(207-356)-pAgTEF1>ble>tAgTEF1-pENO2>GAL3C(S509P)>tENO2-fcy1(454-778)
ExpressionYeastMutationGAL3 (S509P)Available SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
ku70 insUP+ pXYL-G418-tNOS-pADH2-crtE-tNOS-pXYL-crtI-tNOS-pGPD-crtYB-tNOS+ku70 insD (SBE146)
Plasmid#195048Purposecassette for the deletion of ku70 and overexpression of crtE, crtI, and crtYB under different combination of promotersDepositorInsertscrtE
crtI
crtYB
ExpressionYeastPromoterpADH2, pGPD, and pXYLAvailable SinceNov. 21, 2023AvailabilityAcademic Institutions and Nonprofits only