We narrowed to 258 results for: cyanobacteria
-
Plasmid#165584PurposeNative CcmO fusion with a StrepII tag and PDTDepositorInsertCcmO-PDT
UseTagsProtein degradation tagExpressionBacterialMutationPromoterAvailable sinceNov. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPO640
Plasmid#195296PurposepTA106-Myacmini-KanR, donor plasmid with mini-transposon of McCAST (Tn7575).DepositorInsertminiMcCAST (Tn7575) with KanR
UseTagsExpressionBacterialMutationPromoterAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-slr0230-PL31-sgRNANT1-KmR
Plasmid#73221PurposeContains sgRNA which targets GFPmut3b. Under an aTc inducible promoter. Suicide vector inserts into slr0230 site of Synechocystis. Carries kanamycin resistance. Propogates in E. coliDepositorInsertPL31-sgRNA NT1
UseTagsExpressionBacterialMutationPromoterPL31Available sinceFeb. 23, 2016AvailabilityAcademic Institutions and Nonprofits only -
CpcB•PHLS+Cpc
Plasmid#73335PurposeExpresses the PHLS gene as a fusion with the CpcB gene followed by the CmR geneDepositorInsertcpcB•PHLS-CmR
UseTagsExpressionMutationPromotercpc operonAvailable sinceFeb. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
CRISPR-psbA2 point mutation
Plasmid#182929Purposepoint mutation on psbA2 by CRISPR in Synechocystis 6803DepositorInsertsddcpf1
gRNA targeting psbA2 in Synechocystis 6803: gatcttcggtcgcttgatctttc
psbA
UseCRISPRTagsExpressionMutationS264A, and silent mutation to remove PAM sitePromoterAvailable sinceApril 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pOPO635
Plasmid#195297PurposepACYC-plac-MycaTnsABC, lac promoter expressing transposase genes TnsABC of McCAST (Tn7575).DepositorInsertTnsABC operon of McCAST (Tn7575)
UseTagsExpressionBacterialMutationPromoterIPTG inducible lac promoterAvailable sinceMay 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pOPO636
Plasmid#195299PurposepACYC-plac-MycaTnsABCQ, lac promoter expressing transposase genes TnsABCQ of McCAST (Tn7575).DepositorInsertTnsABCQ operon of McCAST (Tn7575)
UseTagsExpressionBacterialMutationPromoterIPTG inducible lac promoterAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
KaiC CI cat-/EE (E77Q; E78Q; S431E; T432E)
Plasmid#41888DepositorInsertKai C CI cat-/EE
UseTagsExpressionBacterialMutationchanged amin acids: 77,78,431 and 432 to glutamatePromotert7Available sinceMarch 19, 2013AvailabilityAcademic Institutions and Nonprofits only -
STREP-SUMO-FLAG-SeKaiC
Plasmid#218179PurposeWT SeKaiC for phosphorylation/dephosphorylation studyDepositorInsertSTREP-SUMO-FLAG-SeKaiC
UseTagsSTREP-TagExpressionBacterialMutationPromoterAvailable sinceJune 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOPO646
Plasmid#195307PurposepBAD322-MycaTnsD, arapBAD promoter expressing cyanobacterial tRNA-Leu gene targeting TnsD protein of McCAST (Tn7575).DepositorInsertTnsD of McCAST
UseTagsExpressionBacterialMutationPromoterArabinose inducible arapBADAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
KaiC CII cat-/EE (E318Q; S431E; T432E)
Plasmid#42498DepositorInsertKaiC CII cat-/EE (E318Q; S431E; T432E)
UseTagsExpressionBacterialMutationE318Q; S431E; T432EPromotert7Available sinceMarch 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
KaiC CI cat- (E77Q;E78Q)
Plasmid#41886DepositorInsertKaiC CI cat -(E77Q;E78Q)
UseTagsExpressionBacterialMutationchanged glutamic acid 77 and 78 to glutaminePromotert7 promoterAvailable sinceMarch 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
KaiC CII cat- (E318Q)
Plasmid#41887DepositorInsertKai C CII cat (E318Q)
UseBl de3 21TagsExpressionBacterialMutationchanged amino acid 318 E to QPromotert7Available sinceMarch 4, 2013AvailabilityAcademic Institutions and Nonprofits only -
pOPO717
Plasmid#195302PurposepBAD322-MycaIDCas-lacZsp5, arapBAD promoter expressing type I-D Cascade and one spacer array of McCAST (Tn7575), the single spacer is lacZ spacer 5.DepositorInsertMcCAST Cascade and lacZ spacer 5 in native array
UseTagsExpressionBacterialMutationPromoterArabinose inducible arapBADAvailable sinceMarch 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-psba1-TetR-PL22-dCas9-SpR
Plasmid#73223PurposeContains dCas9 from S. pyogenes under aTc inducible promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorInsertdCas9 from S. pyogenes
UseTagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPL22Available sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pC0.008
Plasmid#119618PurposeLevel 0 Part. CDSDepositorInserteYFP
UseSynthetic BiologyTagsExpressionMutationbp 242 T to APromoterAvailable sinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
pC0.286
Plasmid#119627PurposeLevel 0 Part. CDSDepositorInsertAbRChl
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable sinceAug. 6, 2019AvailabilityAcademic Institutions and Nonprofits only -
RNA polymerase beta prime subunit FLAG
Plasmid#102337PurposeTargeting plasmids for replacing the S. elongatus PCC 7942 genomic copy of Synpcc7942_1524 (Beta prime subunit of RNA polymerase) with a C-terminal FLAG tagged variant.DepositorInsertRNAP Beta Prime Subunit with C-terminal FLAG TAG
UseTags3x FLAG with 3X GSGS linkerExpressionMutationPromoterAvailable sinceMarch 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pMD19T-psba1-Ppsba2-dCas9-SpR
Plasmid#73220PurposeContains dCas9 from S. pyogenes under constitutive promoter. Suicide vector inserts into psba1 site of Synechocystis. Carries spectinomycin resist. Recommend E. coli Copy cutter for propogation.DepositorInsertdCas9 from S. pyogenes
UseTagsc-mycExpressionBacterialMutationSilent mutation at bp 1341 A->C to remove an E…PromoterPpsbA2Available sinceMarch 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
pJ207 Delta-cpc-KanR
Plasmid#51468PurposeDeletes the cpc operon in Synechocystis and confers kanamycin resistanceDepositorInsertReplacing the cpc operon with kanamycin resistance
UseSynthetic BiologyTagsExpressionMutationPromoterSynechocystis endogenous cpc-operon promoterAvailable sinceNov. 20, 2018AvailabilityAcademic Institutions and Nonprofits only