We narrowed to 10,190 results for: yeast
-
Plasmid#110687PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3
ExpressionYeastAvailable SinceMay 29, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHKU37.1-2.2
Plasmid#110669PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
TagsflagExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHSU65.1-2.2
Plasmid#110677PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
TagsflagExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHSU71.1-2.2
Plasmid#110684PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
TagsflagExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHSU67.1-2.2
Plasmid#110679PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
TagsflagExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHKU32.1-2.2
Plasmid#110664PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertPKS
TagsflagExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCHKU30.2-2.2
Plasmid#110663PurposeExpression of a fungal biosynthetic gene clusterDepositorInsertS_cerevisiae_ADH2-ORF1, S_bayanus_ADH2-ORF2, PCK1-ORF3, MLS1-ORF4
ExpressionYeastAvailable SinceMay 16, 2018AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-R-ARS805a
Plasmid#87408Purposep426_Cas9_gRNA-ARS805a without ribozyme All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS805a sequence TTATTTGAATGATATTTAGT in yeast chromosome 8.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS805a
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pBSWHhc-Lam
Plasmid#133902PurposeNegative control when used in combination with pAWH-largeT. Expression of Gal4BD-Bait hybrid protein. Homology regions for recombination with pAWHDepositorAvailabilityAcademic Institutions and Nonprofits only -
pYG026
Plasmid#65328Purposereporter plasmids used in YeastFab work, in which promoters could be inserted just upstream YFP(YEVenus) to drive its expression, also contains an mCherry gene driven by TEF2 promoter.DepositorInsertccdB
UseUnspecifiedAvailable SinceFeb. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
MoClo Pichia toolkit
Plasmid Kit#1000000108PurposeA collection of control elements and fluorescent reporters that can be used in combination with the MoClo-YTK toolkit for protein expression and secretion in yeast (Pichia pastoris).DepositorAvailable SinceJune 1, 2017AvailabilityAcademic Institutions and Nonprofits only -
AID* Kit
Plasmid Kit#1000000120PurposeExpanded tool kit for the auxin-inducible degron (AID) system in yeast ( S. cerevisiae). Includes tags for easy detection by antibodies/microscopy and a set of selection markers.DepositorAvailable SinceJan. 10, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCut plasmid toolkit
Plasmid Kit#1000000118PurposeCas9-based kit in S. cerevisiae for optimizing heterologous gene expression. Cas9-sgRNA (pCut) plasmids for integrating into 23 loci, across all 16 yeast chromosomes.DepositorAvailable SinceAug. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
pPICZc-HsACTB*-thymosinB-8His
Plasmid#111146PurposeExpresses human beta-actin fused with thymosin beta and a His tag.DepositorInsertACTB (ACTB Human)
UsePichia pastoris integrationTagsThymosin beta and a His-tagExpressionYeastPromoterAOX1Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only -
WT (DVD)
Plasmid#184316PurposeTo study dynamics of G-actin using NMR spectroscopy.DepositorAvailable SinceMay 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-HRV-B14_3C
Plasmid#203466PurposeExpresses HRV-B14 3C protease from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-EMCV_3C
Plasmid#201941PurposeExpresses EMCV 3C protease from a GAL promoter with a URA3 markerDepositorAvailable SinceAug. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN-L1-K2-L2
Plasmid#80684PurposeGateway Entry vector containing a temperature-sensitive mouse DHFRDepositorUseSynthetic BiologyTags3xHAExpressionBacterial, Insect, Mammalia…Mutationmouse DHFR with N-terminal UbiquitinAvailable SinceAug. 16, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL-DENV_NS3-GS-NS2B
Plasmid#201940PurposeExpresses DENV NS2B-NS3 protease (with GS linker) from a GAL promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG416GAL10-WNV_NS2B-GS-NS3
Plasmid#203475PurposeExpresses WNV NS2B-NS3 protease (with GS linker) from a GAL10 promoter with a URA3 markerDepositorAvailable SinceJuly 31, 2023AvailabilityAcademic Institutions and Nonprofits only