We narrowed to 3,673 results for: ara-2
-
Plasmid#79566Purposeexpression of CRY2PHR fused to inositol 5-phosphatase domain of OCRLDepositorInsertOCRL (OCRL Human)
TagsCRY2 (photolyase homology region domain of Arabid…ExpressionMammalianMutationaa 234_539PromoterCMVAvailable SinceAug. 9, 2016AvailabilityAcademic Institutions and Nonprofits only -
RPK2 X042_pECIA14
Plasmid#114935PurposePrey vector RPK2 X042_pECIA14 should be used with bait vector RPK2 X042_pECIA2.DepositorAvailable SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
RPK2 X042_pECIA2
Plasmid#115135PurposeBait vector RPK2 X042_pECIA2 should be used with prey vector RPK2 X042_pECIA14.DepositorInsertAT3G02130 (RPK2 Mustard Weed)
TagsFc, V5 and hexahistidine tagsExpressionInsectPromoterMetallothionein (Copper-Inducible)Available SinceMarch 21, 2019AvailabilityAcademic Institutions and Nonprofits only -
pOmniBac zz TEV YBBR TRF2
Plasmid#185443PurposeExpresses human TRF2 with a zz affinity tag, YBBR labeling site, and TEV cleavage site in insect cellsDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pT7-SpCas9_sgRNA-site2 (RTW448)
Plasmid#160137PurposeT7 promoter expression plasmid for in vitro transcription of SpCas9 sgRNA with spacer #2DepositorInsertSpCas9 sgRNA with spacer #2 (spacer=GTCGCCCTCGAACTTCACCT)
UseIn vitro transcription of sgrna from t7 promoterPromoterT7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only -
INCTbiosyn-p35S(rc)2_4_5-GFP
Plasmid#127520PurposePlasmid has an inverted CaMV 35S promoter sequence (reverse complement) flanked by attB and attP attachment sites of integrases 2, 4, and 5. EGFP coding sequence is in the forward orientation.DepositorInsertCaMV 35S reverse complement promoter sequence flanked by attB/attP Integrase 2, 4 and 5 attachment sites.
ExpressionPlantAvailable SinceMay 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG12A/sgKras/Cre
Plasmid#99849PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G12A mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
AAV-KrasG13C/sgKras/Cre
Plasmid#99856PurposeExpresses Cre-recombinase, a barcoded HDR template to introduce a G13C mutation into the endogenous Kras locus, and a Kras-targeting sgRNA to enhance HDR.DepositorInsertKras (Kras Mouse)
UseAAV and Cre/LoxExpressionMammalianMutationAvrII site (CAAAGG>CCTAGG), PAM/sgRNA mutation…Available SinceDec. 13, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLENTICRISPR V2 hygro sgmPOLE_2
Plasmid#241443PurposeDelete mouse PoleDepositorAvailable SinceJan. 2, 2026AvailabilityAcademic Institutions and Nonprofits only -
pOP795
Plasmid#235700PurposeProtein expression His-taged HsNRBF2_FL in bacteriaDepositorAvailable SinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(+6)-L2
Plasmid#205040PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(+6)-L2
TagsGRRGKKSRKGRRGKKSRK and MGHHHHHGGAExpressionBacterialMutationE16R, D86K, D112K, D127R, I138R, D207R, N222K, L2…Available SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(+6)-H2
Plasmid#205043PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(+6)-H2
TagsKRRRKKKRRRKK and MGHHHHHGGAExpressionBacterialMutationE16R, D86K, D112K, D127R, I138R, D207R, N222K, L2…Available SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-mCherry(-6)-L2
Plasmid#205047PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertmCherry(-6)-L2
TagsMGHHHHHGGExpressionBacterialAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(0)-L2
Plasmid#205034PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(0)-L2
TagsGRRGKKSRKGRRGKKSRK and MGHHHHHGGAExpressionBacterialMutationE16R, I138R, D207R, N222K, L246RAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET-6xHis-GFP(0)-H2
Plasmid#205037PurposeFluorescent protein with charge-patterned cationic peptide to promote biomolecular condensate formation in E. coliDepositorInsertGFP(0)-H2
TagsKRRRKKKRRRKK and MGHHHHHGGAExpressionBacterialMutationE16R, I138R, D207R, N222K, L246RAvailable SinceFeb. 9, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV/EF1a::DIO-iLMO2
Plasmid#129482PurposeAAV2 transfer plasmid for Cre-dependent expression of iLMO2, an opto-chemogenetic probe for neuronal inhibition by light or chemicalDepositorInsertiLMO2
UseAAVExpressionMammalianPromoterEF1aAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV/CaMKIIa::iLMO2
Plasmid#129481PurposeAAV2 transfer plasmid for iLMO2, an opto-chemogenetic probe for neuronal inhibition by light or chemical, under control of the glutamatergic-selective CaMKIIa promoterDepositorInsertiLMO2
UseAAVExpressionMammalianPromoterCaMKIIaAvailable SinceFeb. 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUiLMO2W
Plasmid#129480Purpose3rd-generation lentiviral vector for iLMO2, an opto-chemogenetic probe for neuronal inhibition by light or chemicalDepositorInsertiLMO2
UseLentiviralExpressionMammalianPromoterhuman ubiquitin CAvailable SinceFeb. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3-iLMO2
Plasmid#129474PurposeMammalian expression vector for iLMO2, an opto-chemogenetic probe for neuronal inhibition by light or chemicalDepositorInsertiLMO2
ExpressionMammalianPromoterCMVAvailable SinceFeb. 10, 2023AvailabilityAcademic Institutions and Nonprofits only -
pVY-10 mScarletI-tag2
Plasmid#194625Purposefluorescent proteins with cationic peptide tags to promote biomolecular condensate formation in E. coliDepositorInsertmScarlet-I-(GGSKKRKKR)2
TagsGGSKKRKKRGGSKKRKKR and MGHHHHHGGAExpressionBacterialPromoterT7Available SinceJan. 27, 2023AvailabilityAcademic Institutions and Nonprofits only