We narrowed to 11,940 results for: 110
-
Plasmid#157784Purposedonor plasmid for C-terminal FLAG tag fusion of human FMR1DepositorAvailable SinceDec. 11, 2020AvailabilityAcademic Institutions and Nonprofits only
-
pET28_WT-LGP2 (codon optimized)
Plasmid#248163PurposeExpresses full-length human LGP2 in E. coliDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMV0067 [15ARE23bp -p(cFos)-fLuc-UBC-rLuc-P2A-GFP]
Plasmid#246421PurposeFirefly luciferase driven by an AHR responsive minimal cFOS promoter and a renilla luciferase and GFP driven by a constitutive UBC promoter flipped with respect to the lentiviral backboneDepositorInsertsFirefly luciferase
Renilla luciferase-P2A-EGFP
UseLentiviralExpressionMammalianPromoterAHR responsive minimal cFOS promoter and UbCAvailable SinceOct. 9, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT2K-CAGGS-T2TP
Plasmid#114725Purposeexpression in mammalian cellsDepositorInsertTol2 transposase
ExpressionMammalianAvailable SinceSept. 18, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSG5-HA-p300-DY1399
Plasmid#89095Purposemammalian expression of full-length human p300 with DY1399 mutation, acetylation mutant, acetyltransferase activity defectDepositorInsertp300-D1399Y mutant (EP300 Human)
TagsHAExpressionMammalianMutationp300-DY1399PromoterSV40Available SinceApril 21, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV hU6-gRNA hUbC-VP64-dSaCas9-VP64-T2A-Thy1.1
Plasmid#194279PurposeExpresses gRNA and VP64-dSaCas9-VP64 from lentiviral vectorDepositorInsertshumanized VP64 dSaCas9 VP64 T2A Thy1.1
gRNA
UseCRISPR and LentiviralTagsHAExpressionMammalianPromoterhU6 and hUbCAvailable SinceFeb. 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pMT-sfGFP-TurboID
Plasmid#240231PurposeExpression of sfGFP-TurboID under control of copper-inducible promoter. Can be used to generate stable cell lines by Hygromycin selection.DepositorInsertsfGFP-TurboID
ExpressionInsectPromoterMTAvailable SinceJuly 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
GFP-PBRM1
Plasmid#65387PurposeGFP-tagged BRD protein, which can be used to be expressed in mammalian cells.DepositorAvailable SinceMay 14, 2015AvailabilityAcademic Institutions and Nonprofits only -
pCIP-Flag-TfebAA
Plasmid#79014PurposeFor mammalian expression of a Flag-tagged, constitutively active version (S142A, S211A) of Tfeb.DepositorAvailable SinceJuly 15, 2016AvailabilityAcademic Institutions and Nonprofits only -
ITPKA-mTurquoise2
Plasmid#137811PurposeIn vivo visualization of actin cytoskeleton (can be used for colocalization studies)DepositorAvailable SinceFeb. 27, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-pA-M.EcoGII
Plasmid#192873PurposepA-M.EcoGII expression plasmid, originally created for BIND&MODIFY method, a Long-range single-molecule mapping of chromatin modification in eukaryotes. doi: https://doi.org/10.1101/2021.07.08.451578DepositorInsertpA-M.EcoGII
Tags3X Flag TagExpressionBacterialPromoterT7Available SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti NG-ABE8e_P2A_GFP + PuroR
Plasmid#242000PurposeLentiviral plasmid for generation of cell lines stably expressing NG-ABE8e base editor. NG-ABE8e expression can be followed by GFP fluorescence. Contains PGK-puromycin resistance cassette.DepositorInsertNG-ABE8e
UseCRISPR and LentiviralExpressionMammalianAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pcDNA GNSTM-3-Flag-10-Lamp2b-HA
Plasmid#71293PurposeEncodes (N to C): GNSTM glycosylation motif, 3 residue spacer, Flag tag,10 residue spacer, Lamp2b (exosomal transmembrane protein), 3 residue spacer, HA tag.DepositorInsertLamp2b (LAMP2 Human)
TagsFLAG, GNSTM glycosylation motif, HA, and Lamp2 si…ExpressionMammalianPromoterCMVAvailable SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
pcDNA Flag Lamp2b-HA
Plasmid#71292PurposeFlag tag with 3 residue spacer fused to the N-terminus of Lamp2b, a transmembrane exosomal protein. 3 residue spacer then HA tag fused to the C-terminus of Lamp2b.DepositorInsertLamp2b (LAMP2 Human)
TagsFlag, HA, and Lamp2 signal peptideExpressionMammalianPromoterCMVAvailable SinceDec. 4, 2015AvailabilityAcademic Institutions and Nonprofits only -
Sox2-t2A-GFP
Plasmid#127537PurposeExpresses human SOX2 and eGFP via t2A linker.DepositorAvailable SinceJuly 22, 2019AvailabilityAcademic Institutions and Nonprofits only -
GFP-itis pBE-t
Plasmid#195342PurposeBase editor plasmid expressing ABE8e-NG-Cas9n under Theophylline Riboswitch and constituitively expressed gRNA targeting EGFP A110VDepositorInsertsecTadA(8e)-SpCas9-NG
gRNA ctctacgcgggtcttgtagt
UseCRISPRMutationSpCas9n-NG: D10A, L1111R, D1135V, G1218R, E1219F,…PromoterLac and ProCAvailable SinceJan. 31, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBS CMV NA 3C FLAG SA
Plasmid#234993PurposeExpression of transmembrane region of Neuraminidase protein fused to streptavidin protein for displaying on viral like particles (VLPs) when cotranfected with GAG proteinDepositorInsertNA
TagsHRV 3C site, FLAG, Strep-Tactin (SA)ExpressionMammalianMutationIn the Streptavidin coding sequence Glu44Val/Ser4…Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pNA 3C myc scfvHA
Plasmid#234991PurposeExpression of transmembrane region of Neuraminidase protein fused to an anti HA scFv antibody fragment for displaying on Viral like particles (VLPs) when cotranfected with GAG proteinsDepositorInsertNA-3C-myc-scfvHA
ExpressionMammalianAvailable SinceMarch 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pIR-CMV-SCN2A-Variant-4-IRES-mScarlet
Plasmid#209410PurposeExpression of wild-type neonatal isoform of human SCN2A.DepositorInsertSCN2A Variant 4, stabilized (SCN2A Human)
ExpressionMammalianMutationIVS intron inserted after bp 4551 of the SCN2A OR…PromoterCMVAvailable SinceJan. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pIS1-Vim/Actb5UTR-renilla
Plasmid#38238DepositorUseLuciferaseExpressionMammalianMutationActb promoter (1000 nt upstream) and 5' UTR …PromoterEndogenous VimAvailable SinceNov. 7, 2012AvailabilityAcademic Institutions and Nonprofits only