We narrowed to 11,631 results for: 110
-
Plasmid#110821PurposeImproved dCas9 repressor-dCas9-KRAB-MeCP2DepositorInsertdCas9-KRAB-MeCP2
ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…PromoterCMVAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDGM6
Plasmid#110660PurposeAdeno-Associated Virus (AAV) serotype 6; contains the AAV6 cap genes, AAV2 rep genes, and adenovirus helper genes. Good for in vivo transduction of muscle, lung, liver and other tissues.DepositorInsertAAV6 cap genes, AAV2 rep genes, adenovirus helper genes
UseAAVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
Human Parkin (1-465)
Plasmid#110758PurposeBacterial expression of human ParkinDepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRepCap6
Plasmid#110770PurposepRepCap6 contains both rep and cap genes from the AAV6 genome, but lacks the viral terminal repeats (Rutledge et al., 1998). It lacks adenovirus helper functions required for stock production.DepositorInsertAAV6 cap, AAV6 rep genes
UseAAVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pmTurquoise2-LC3
Plasmid#110947PurposeExpresses the autophagosome marker LC3 fused to mTurquoise2DepositorInsertMicrotubule-associated proteins 1A/1B light chain 3B (MAP1LC3B Human)
TagsmTurquoise2ExpressionMammalianAvailable SinceFeb. 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
AAV-P(Per2)-DIO-intron2-dLUC
Plasmid#110059PurposePer2 transcription luciferase reporterDepositorInsertPer2 promoter and luciferase (Per2 Mouse)
UseAAV and Cre/LoxExpressionMammalianPromoterPer2Available SinceMay 30, 2018AvailabilityAcademic Institutions and Nonprofits only -
FUW mCherry-GFP-LC3
Plasmid#110060PurposeTo visualize free autophagosomes (GFP and mCherry fluorescence) and autophagosomes that have fused with the lysosome (autolyosomes; mCherry fluorescence only, due to acid sensitivity of GFP)DepositorInsertmCherry-GFP-LC3
UseLentiviralAvailable SinceMay 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
dCas9-KRAB
Plasmid#110820PurposeConventional dCas9 repressor-dCas9-KRABDepositorInsertdCas9-KRAB
ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…PromoterCMVAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
EGFR WT
Plasmid#11011PurposeRetroviral construct for expressing human EGFR in human cellsDepositorAvailable SinceJan. 5, 2006AvailabilityAcademic Institutions and Nonprofits only -
pRSET-6xTR-TUBE
Plasmid#110313PurposeE. coli expression and purification of 6xTR-TUBEDepositorInsert6xTR-TUBE (UBQLN1 Human)
TagsN-terminal His6-T7 tagExpressionBacterialMutationAll Arg residues in the UBA domain are mutated to…PromoterT7Available SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
EFS-GFP
Plasmid#110834Purposepositive control for GFP expressionDepositorInsertelongation factor 1alpha binding sequence (EFS) at GFP promoter region
UseLentiviralExpressionMammalianAvailable SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pB-CAGGS-dCas9-KRAB-MeCP2
Plasmid#110824PurposePiggyBac compatible plasmid expressing dCas9-KRAB-MeCP2DepositorInsertdCas9-KRAB-MeCP2
ExpressionMammalianMutationCas9 mutations to make dCas9=D10A+D839A+H840A+N86…PromoterCAGGSAvailable SinceJuly 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
STAT3-GFP
Plasmid#110495Purposereporter of STAT3 signaling activityDepositorInsert4 repeats of STAT3 binding site M67 at GFP promoter region
UseLentiviralExpressionMammalianAvailable SinceMay 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pRSET-4xTR-TUBE
Plasmid#110312PurposeE. coli expression and purification of 4xTR-TUBEDepositorInsert4xTR-TUBE (UBQLN1 Human)
TagsN-terminal His6-T7 tagExpressionBacterialMutationAll Arg residues in the UBA domain are mutated to…PromoterT7Available SinceMay 17, 2018AvailabilityAcademic Institutions and Nonprofits only -
Human USP30 (1-517, WT, MG-38-11)
Plasmid#110748PurposeTransient transfection of human USP30DepositorAvailable SinceJune 14, 2018AvailabilityAcademic Institutions and Nonprofits only -
pYES2.1-TRP1
Plasmid#11007DepositorInsertTRP1 (TRP1 Budding Yeast)
TagsV5 and his6ExpressionBacterial and YeastMutationORF-TRP1 without stop codonAvailable SinceDec. 16, 2005AvailabilityAcademic Institutions and Nonprofits only -
SB_concave
Plasmid#110102PurposepBXPHM3 with scaffold Sybody of the concave libraryDepositorInsertscaffold Sybody of the concave library
TagsHisExpressionBacterialPromoterPBADAvailable SinceMay 24, 2018AvailabilityAcademic Institutions and Nonprofits only -
pDGM3B
Plasmid#110809Purposecontains the AAV3B cap genes, AAV2 rep genes, and also adenovirus helper genesDepositorInsertAAV3B cap genes, AAV2 rep genes, adenovirus helper genes
UseAAVAvailable SinceJune 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLenti-U6-tdTomato-P2A-BlasR (LRT2B)
Plasmid#110854PurposeLentiviral vector for constitutive expression of sgRNAs; includes tdTomato and BlasticidinS resistance markersDepositorInsertsgRNA scaffold with spacer
UseLentiviralMutationWTPromoterU6Available SinceJune 27, 2018AvailabilityAcademic Institutions and Nonprofits only