We narrowed to 31,294 results for: FUS
-
Plasmid#182716PurposeConstituitvely expressed CasRx crRNA cloning vector, truncated 3' terminator region, with eGFP for cloningDepositorInsertCasRx crRNA cloning backbone
UseCRISPRTagsGFP in cloning site of crRNA for easier screening…ExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-C1-BBS7
Plasmid#218715PurposeExpresses N-terminally EGFP-tagged BBS7 in mammalian cellsDepositorAvailable SinceMay 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-TP3
Plasmid#160086PurposeBacterial expression of Tn5-APEX2 fusion protein with linker AEAAAKEAAAKADepositorInsertTn5 transposase/APEX2 peroxidase fusion protein
TagsFLAG and Mxe intein - Chitin-binding domainExpressionBacterialAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pTXB1-TP5
Plasmid#160088PurposeBacterial expression of Tn5-APEX2 fusion protein with linker GSGAGADepositorInsertTn5 transposase/APEX2 peroxidase fusion protein
TagsFLAG and Mxe intein - Chitin-binding domainExpressionBacterialAvailable SinceNov. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSLGCV
Plasmid#49862PurposeExpression in Caenorhabditis elegans of the luc+ gene (Promega), fused in frame to GFP (S65C), under the sur-5 promoter (from plasmid pTG96, John Yochem and Min Han). Backbone pPD95.79 (Firelab).DepositorInsertfirefly luciferase luc+ fused to GFP (S65C)
TagsGFP (S65C)ExpressionWormPromotersur-5Available SinceApril 17, 2014AvailabilityAcademic Institutions and Nonprofits only -
pCMV-hA3D-BE3
Plasmid#113413PurposeExpresses hA3D-BE3 in mammalian cellsDepositorInserthA3D-BE3 (APOBEC3D Human, S. pyogenes and Bacteriophage PBS2)
UseCRISPRExpressionMammalianPromoterCMVAvailable SinceAug. 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEF5B-FRT-AP-Smo-YFP-DEST
Plasmid#49099PurposeExpressing AP-Smo-YFP in mammalian cells, can be used for establishing Flp-In stable cell linesDepositorAvailable SinceNov. 8, 2013AvailabilityAcademic Institutions and Nonprofits only -
mCyRFP1-RhoA
Plasmid#84358Purposefusion protein of RhoA, FRET donorDepositorInsertmCyRFP1-RhoA (RHOA Human, Synthetic)
TagsmCyRFP1 N terminal fusion to RhoAExpressionMammalianPromoterCMVAvailable SinceNov. 22, 2016AvailabilityAcademic Institutions and Nonprofits only -
Affibody HER2:243.BirA*-pET301/NT-DEST
Plasmid#174692PurposePlasmid encoding for the bacterial expression of a bispecific coding for the anti-HER2 affibody ZHER2:342 fused to the mutated form of BirA enzyme, BirA*DepositorInsertAnti-HER2 affibody ZHER2:342 fused to mutated form of BirA, BirA*
TagsHIS tagExpressionBacterialMutationR118G mutation in BirAPromoterT7 promoterAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
GA-MFF
Plasmid#141160PurposeDimerization-dependent green fluorescent protein targeted to mitochondrial outer membraneDepositorAvailable SinceAug. 28, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSC-PreE2
Plasmid#52264PurposeBacterial expression of GST-tagged TARGET proteins fused to SUMO-E2 with PreScission protease cleavage site linkerDepositorAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBbB8k-csg-nb112
Plasmid#171702PurposeArabinose-inducible csgBACEFG operon for curli fiber synthesis in which curli subunit CsgA has been fused to a nanobody targeting the spike protein of SARS-CoV-2 via a flexible linker.DepositorInsertcsgBACEFG, with nanobody fused to CsgA
UseSynthetic BiologyExpressionBacterialAvailable SinceJune 30, 2021AvailabilityAcademic Institutions and Nonprofits only -
LLP109 pEF1a-gRNA-GFP
Plasmid#100935PurposeGFP, puromycin and gRNA scaffold driven by EF1a promoterDepositorInsertgRNA scaffold
UseGrna scaffoldExpressionMammalianAvailable SinceJune 21, 2018AvailabilityAcademic Institutions and Nonprofits only -
pSNV2 CHER NLS cop1at(335-675)
Plasmid#44972DepositorInsertmCherry-NLS-COP1 (COP1 Mustard Weed)
TagsNLS and mCherryExpressionMammalianMutationdeleted amino acids 1-334PromoterpCMV IEAvailable SinceJune 6, 2013AvailabilityAcademic Institutions and Nonprofits only -
pHR SFFVp MCP-mCherry IRES h2b-diRFP
Plasmid#102351PurposeLentiral expression vector bearing the MS2 Coat Protein (MCP) fused to mCherry as well as the nuclear marker histone 2b fused to two copies of irFP. Also bears the hygromycin selection marker.DepositorInsertMS2 Coat Protein
UseLentiviralTagsmCherryPromoterSFFVAvailable SinceJan. 22, 2018AvailabilityAcademic Institutions and Nonprofits only -
pCD5-D/bovine/Nebraska/9-5/2012-HEFs57aED-GCN4-sfGFP-ST
Plasmid#175020PurposeExpresses influenza D virus trimeric hemagglutinin esterase fusion protein fused to a sfGFPDepositorInsertD/bovine/Nebraska/9-5/2012
TagsGCN4-TEV-sfGFP-TwinStrepExpressionMammalianMutations57a esterase knock out mutantPromoterCMVAvailable SinceJan. 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSC-IntE2
Plasmid#52265PurposeBacterial expression of GST-tagged TARGET proteins fused to SUMO-E2 with GyrA intein linkerDepositorAvailable SinceJuly 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pET14b-dabAB2
Plasmid#133013PurposepET14b carrying the dabA2 gene (Uniprot: D0KWS7) with a c-terminal strep tag fusion and the dabB2 gene (Uniprot: D0KWS8) with a c-terminal sfGFP V206K fusion and 6xHis tagDepositorInsertsdabB2
dabA2
Tags6xHis, StrepII tag, and sfGFPExpressionBacterialPromotert7Available SinceNov. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
pCMV-ADARcd-YTHmut
Plasmid#194431PurposeADAR1 catalytic domain E488Q fused to YTHmutDepositorInsertADARcd fused to YTHmut domain (ADAR Human)
TagsADARcd-YTHmut-HAExpressionMammalianMutationm6A binding region of YTH domain is deletedAvailable SinceJan. 20, 2023AvailabilityAcademic Institutions and Nonprofits only -
(318) pcDNA3.1-myc-OGA(1-400)D174N
Plasmid#168096PurposeMyc tagged inactive truncated human OGA catalytic domain of residues 1-400 with D174N mutationDepositorInsertmyc-OGA(1-400, D174N)
TagsmycExpressionMammalianMutationD174N catalytically inactive OGAPromoterT7/CMVAvailable SinceMay 18, 2021AvailabilityAcademic Institutions and Nonprofits only