We narrowed to 19,308 results for: cat
-
Plasmid#210368PurposeExpresses DNAJC11 fused with EGFP in mammalian cellsDepositorAvailable SinceDec. 18, 2023AvailabilityAcademic Institutions and Nonprofits only
-
pDN0605 (pDEST-DHFR F[1,2] N-term, NatR)
Plasmid#210487PurposepDEST vector to tag gene of interest with DHFR F[1,2] on the N-terminus to perform DHFR-PCA in S. cerevisiae.DepositorTypeEmpty backboneUseSynthetic Biology; Destination vector for gateway…ExpressionYeastPromoterADH1Available SinceDec. 4, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R196M wgMDH
Plasmid#204273PurposeBacterial expression of R196M wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR196MAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R124K wgMDH
Plasmid#204258PurposeBacterial expression of R124K wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR124KAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 Q58L wgMDH
Plasmid#204246PurposeBacterial expression of Q58L wgMDH with IPTG induction - Subunit interface mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationQ58LPromoterT5Available SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R124Q wgMDH
Plasmid#204259PurposeBacterial expression of R124Q wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR124QAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 D193E wgMDH
Plasmid#204269PurposeBacterial expression of D193E wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationD193EAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pQE60 R130E wgMDH
Plasmid#204267PurposeBacterial expression of R130E wgMDH with IPTG induction - Active site mutantInsertMDHG_CITLA
Tags6X HisExpressionBacterialMutationR130EAvailable SinceOct. 23, 2023AvailabilityAcademic Institutions and Nonprofits only -
pRS314-prp16-302
Plasmid#89974Purposeprp16-302 allele in TRP plasmidDepositorAvailable SinceAug. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-TPI1_sgRNA1
Plasmid#201626PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertTPI1 (TPI1 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-EF1a-DIO-mCherry-WPRE
Plasmid#202620PurposeDouble floxed red fluorescent protein mCherry in AAV production vector expressed under the mammalian promoter (EF1a)DepositorInsertmCherry
UseAAV and Cre/LoxExpressionMammalianPromoterEF1aAvailable SinceJune 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAG306-pTet07-synYFP[TTG/AGA]-nLuc
Plasmid#199756PurposeElongation reporter construct to quantify elongation of synYFP[TTG]; Control construct of elongation reporter to quantify elongation duration of n_CGA stallingDepositorInsertsynYFP[TTG/AGA]-nLuc
ExpressionYeastPromoterTetO7Available SinceMay 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
pTS115 pHAGE2 CMVtetO2 MCS-3C-SUMOstar-22xGS-Alfa-P2A-TagBFP
Plasmid#199368PurposeLentiviral transfer plasmid for doxycycline inducible expression of a C-terminally 3C-SUMOstar-ALFA-P2A-BFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTags3C-SUMOstar-ALFA-P2A-TagBFPExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459-sgRNA1-CTCF-prom
Plasmid#195103PurposeVector for transient expression of spCas9-nuclease (V2.0) and a sgRNA targeting upstream of the human CTCF promoter. Puromycin selection (2A-fusion).DepositorInsertsgRNA against CTCF promoter
UseCRISPRExpressionMammalianAvailable SinceFeb. 3, 2023AvailabilityAcademic Institutions and Nonprofits only -
pS238D1::sptse5-CT
Plasmid#192959PurposeFor expression of Tse5-CT (1169-1317) in P. putida with the PelB signal peptide fused at the N-terminus in biological function studiesDepositorInsertsptse5-CT
TagsPelB signal peptideExpressionBacterialMutationencodes for tse5 (1169-1317)Available SinceDec. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
Lenti-sgCrebbp#1/Cre
Plasmid#193209PurposeLentiviral vector expressing Cre recombinase (driven by mPGK promoter) and an sgRNA against the mouse Crebbp geneDepositorAvailable SinceDec. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pIAeBlueHPV16LR
Plasmid#185894PurposeIn vivo gene amplification (HapAmp) of AeBlue + HPV16 L1 expression module at RPL25 locusDepositorInsertPRPL25(Arm1)>Kl.LEU2>TKl.LEU2-TRPL25(Arm3)-ARS305-PALD6>EforRed>TPGK1-PSe.GAL2>HPV16-L1_C-6*H>TRPL41B-PBTS1>RPL25(partial;Arm2)
ExpressionYeastMutationNoneAvailable SinceNov. 14, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEasyG2_nat
Plasmid#184914PurposeTemplate to generate via PCR two gRNAs for expression in S. cerevisiae. The PCR product from pEasyG2_nat recombines in vivo with a PCR product from pEasyG2_mic.DepositorInsertgRNA scaffold
UseCRISPRExpressionBacterialAvailable SinceOct. 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable SinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pINER2R
Plasmid#185882PurposeIn vivo gene amplification (HapAmp) of nerolidol synthetic module at RPL25 locus (11 copy).DepositorInsertPRPL25(Arm 1)>Kl.LEU2>TKl.LEU2-PGAL1>ERG20>TRPL3-TRPL25(Arm 3)-ARS305-PGAL2>Y.FAST-EVBR1.2A-AcNES1>TRPL41B>RPL25(partial; Arm2)
ExpressionYeastMutationNoneAvailable SinceSept. 1, 2022AvailabilityAcademic Institutions and Nonprofits only