We narrowed to 27,806 results for: gfp
-
Plasmid#191011PurposeExpresses EGFP-tagged MASTL WT with resistance to MASTL siRNA (ACGCCTTATTCTAGCAAATTA)DepositorInsertMicrotubule-associated serine/threonine kinase like (MASTL Human)
TagsEGFPExpressionMammalianAvailable SinceNov. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-GFP-IRES-mSNCA
Plasmid#185714PurposeAAV expression of GFP and mouse α-Synuclein from hSyn promoterDepositorAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3puro-EGFP-FXR1-isoform b
Plasmid#225449PurposeExpress EGFP-fusion protein of FXR1 isoform bDepositorAvailable SinceNov. 20, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-EF1a-GFP-SFPQ-IRES-mCherry
Plasmid#166950PurposeLentiviral plasmid expressing GFP-tagged SFPQ protein with IRES-mCherry from the EF1a promoterDepositorAvailable SinceMarch 19, 2021AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-Pcdh19-GFP
Plasmid#35675DepositorAvailable SinceApril 19, 2012AvailabilityAcademic Institutions and Nonprofits only -
KZ901: pMVP (L3-L2) P2A-eGFP + WPRE
Plasmid#121772PurposepMVP L3-L2 entry plasmid, contains eGFP-P2A + WPRE for 3- or 4-component MultiSite Gateway Pro assembly. Allows expression of C-term eGFP linked by P2A to gene of interest in lentivirus vectors.DepositorInsertP2A-eGFP + WPRE
UseGateway Cloning and Synthetic BiologyAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
EK0395 mCherry-SG(s70587)SG-EGFP (pEAQ)
Plasmid#191170PurposeEK0285 in plant-expressable format: Sensor 1 (for EK0208); mCherry marker, EGFP output.DepositorInsertmCherry:s70587:EGFP (plant)
ExpressionPlantMutationWTAvailable SinceOct. 26, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSLQ2853-3 pHR: U6-Sasgv2CXCR4-1 CMV-EGFP
Plasmid#84254PurposeExpresses optimized Sa sgCXCR4-1 gRNA with an EGFP fluorescent markerDepositorInsertSa sgCXCR4-1
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ1852-2 pHR: U6-SpsgCD95-1 CMV-EGFP
Plasmid#84251PurposeExpresses Sp sgCD95-1 gRNA with an EGFP fluorescent markerDepositorInsertSp sgCD95-1
UseCRISPR and LentiviralExpressionMammalianPromotermouse U6Available SinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pLenti-PGK-EGFP-ALDH1A2-Neo
Plasmid#189743PurposeThe construct was used to express GFP tagged human ALDH1A2 in mammalian cells for the analysis of the subcellular location of this protein.DepositorAvailable SinceOct. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-GFP (PX458)
Plasmid#129026Purposeinactivated control (targeted DNA demethylation),expression of dCas9-hudTET1CD-T2A-EGFP and cloning backbone for sgRNADepositorInsertdCas9-hudTET1CD, SgRNA cloning site
TagsHA-Tag, NLS and T2A-EGFPExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pLVX-EF1alpha-nCoV2019-N-meGFP-IRES-Puro
Plasmid#185451PurposeExpresses SARS-CoV-2 nucleocapsid protein with a c-terminal monomeric EGFP in mammalian cellsDepositorAvailable SinceJune 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-hTipin (pc4732)
Plasmid#216862PurposeMammalian expression vector encoding GFP tagged human TipinDepositorAvailable SinceJuly 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
GFP-LacI-polylinker
Plasmid#179271PurposeCloning of GFP-LacI fusion proteins for LacI/LacO tetheringDepositorTypeEmpty backboneTagsGFP and LacIExpressionMammalianPromoterCMVAvailable SinceMarch 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-N1-mSNX27-ΔF3
Plasmid#163618Purposemouse SNX27 without the F3 domain cDNA C-terminally tagged with GFPDepositorAvailable SinceJan. 13, 2021AvailabilityAcademic Institutions and Nonprofits only -
pAc5.1B-EGFP-Dm4E-T
Plasmid#79261PurposeExpresses EGFP-tagged Dm4E-T in S2 cellsDepositorAvailable SinceJuly 27, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTS106 pHAGE2 CMVtetO2 MCS-3C-SUMOEu-22xGS-GFP
Plasmid#199359PurposeLentiviral transfer plasmid for doxycycline inducible expression of a C-terminally 3C-SUMOEu-GFP-tagged protein in mammalian cells.DepositorTypeEmpty backboneUseLentiviralTags3C-SUMOEu-EGFPExpressionMammalianMutationWTAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
MTS-EGFP-FLAG-APEX2
Plasmid#251713PurposeExpresses mitochondrial EGFP-FLAG-APEX2 in mammalian cellsDepositorInsertMitochondrial targeting sequence (MTS) (APEX2 Human)
TagsAPEX2, EGFP, and FLAGExpressionMammalianAvailable SinceApril 1, 2026AvailabilityAcademic Institutions and Nonprofits only -
pIRES-GFP-hFJX1-myc
Plasmid#46928Purposecoexpression of FJX1-myc and GFP in mammalian cellsDepositorAvailable SinceAug. 13, 2013AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-AsCas12a-P2A-EGFP (RTW2861)
Plasmid#160140PurposeCMV and T7 promoter expression plasmid for human codon optimized AsCas12a with a c-terminal NLS(nucleoplasmin), 3x HA tag, and P2A-EGFPDepositorInserthuman codon optimized AsCas12a with NLS(nucleoplasmin)-3xHA-P2A-EGFP
UseIn vitro transcription; t7 promoterTagsNLS(nucleoplasmin)-3xHA-P2A-EGFPExpressionMammalianPromoterCMV and T7Available SinceFeb. 8, 2021AvailabilityAcademic Institutions and Nonprofits only