We narrowed to 10,674 results for: yeast
-
Plasmid#195044PurposepFA6a derived selection cassette 5' flanked with tCYC1 transcription terminator, allows genome modification without disruption of insertion neighboring genes by transcription interferenceDepositorInsertNatR
UseYeast genomic targetingTagstCYC1 S. cerevisiae, pPGK1 C. glabrata, NatR, tPG…Available SinceFeb. 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pBSWHhc-p53
Plasmid#133903PurposePositive control when used in combination with pAWH-largeT. Expression of Gal4BD-p53 hybrid protein. Homology regions for recombination with pAWHDepositorAvailable SinceDec. 20, 2019AvailabilityAcademic Institutions and Nonprofits only -
pH-eCFP
Plasmid#176555PurposeExpression of eCFP for auxotrophic selection in the absence of histidineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pL-eCFP
Plasmid#176556PurposeExpression of eCFP for auxotrophic selection in the absence of leucineDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
pU-eCFP
Plasmid#176557PurposeExpression of eCFP for auxotrophic selection in the absence of uracilDepositorInserteCFP
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS1622b
Plasmid#87403PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1622b sequence GTCACGTTCCTGAGGTTACT in yeast chromosome 16.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS1622b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
pU-mRuby2
Plasmid#176549PurposeExpression of mRuby2 for auxotrophic selection in the absence of uracilDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceOct. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pH-mRuby2
Plasmid#176547PurposeExpression of mRuby2 for auxotrophic selection in the absence of histidineDepositorInsertyomRuby2
ExpressionYeastPromoterTDH1(GAP)Available SinceApril 6, 2022AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS911b
Plasmid#87394PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS911b sequence GTAATATTGTCTTGTTTCCC in yeast chromosome 9.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS911b
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-H517Q-YFP
Plasmid#29620DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCS2+ cMyc-oDam_f_GFPoNLS
Plasmid#85818PurposeiDamID plasmid. To express transiently the c-Myc-tagged and optimized E. coli Dam adenine methyltransferase fused to the nuclear-localized mmGFP via flexylinker.DepositorInsertcMyc oDam_f_GFPoNLS
TagscMyc and oNLS (optimized nuclear localization sig…ExpressionBacterial, Insect, Mammalia…MutationL122A. Codon optimization compatible to work in M…Available SinceJan. 4, 2017AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-R521H-YFP
Plasmid#29624DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCLASP_Crz1(19A)_CLASP_RGS2membrane
Plasmid#133085PurposePlasmid contains Crz1* with CLASP. This consists of the plasma membrane anchor (pm-LOVTRAP) and the cargo (Zdk-Crz1*-yeLANS). CLASP modulates nuclear localization of Crz1* in response to blue light.DepositorInsertCrz1*-CLASP
ExpressionBacterial and YeastPromoterpADH1Available SinceSept. 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
nuc-yHS1-M7A,H102A
Plasmid#159168PurposeNuclear labile heme reporterDepositorInsertnuc-yHS1-M7A,H102A
TagsSV40 NLSExpressionYeastMutationMutated both Met 7 and His 102 of the cyt b562 mo…PromoterGPDAvailable SinceSept. 29, 2020AvailabilityIndustry, Academic Institutions, and Nonprofits -
426Gal-FUS-1-501aa-YFP
Plasmid#29601DepositorAvailable SinceJune 7, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-373aa-YFP
Plasmid#29598DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-170aa-YFP
Plasmid#29596DepositorAvailable SinceApril 29, 2011AvailabilityAcademic Institutions and Nonprofits only -
G30, Cdc20-mCherry-AID tagging
Plasmid#130270PurposeTagging the Saccharomyces cerevisiae Cdc20 gene with a mCherry and auxin-degron tag, via homologous recombinationDepositorInsertCdc20/mCherry-AID(71-114)-tCYC1-NatMX (CDC20 Synthetic, Budding Yeast)
TagsAID(71-114) and mCherryExpressionYeastPromoterNative promoterAvailable SinceSept. 11, 2019AvailabilityAcademic Institutions and Nonprofits only -
416Gal-FUS-R514G-YFP
Plasmid#29616DepositorAvailable SinceApril 27, 2011AvailabilityAcademic Institutions and Nonprofits only -
426Gal-FUS-1-413aa-YFP
Plasmid#29599DepositorAvailable SinceJuly 18, 2011AvailabilityAcademic Institutions and Nonprofits only