-
Plasmid#26442DepositorInsertcytoplasmic dynein 1 intermediate chain 2 isoform E (exon 1b) (Dync1i2 Mouse)
UseSubcloning and sequencingTagsExpressionMutationN/APromoterAvailable sinceMarch 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
p171 Dync1i1.F
Plasmid#26441DepositorInsertcytoplasmic dynein 1 intermediate chain 1 isoform F (Dync1i1 Mouse)
UseSubcloning and sequencingTagsExpressionMutationN/APromoterAvailable sinceMarch 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
2. p167 Dync1i1.D
Plasmid#26439DepositorInsertcytoplasmic dynein 1 intermediate chain 1 isoform D (Dync1i1 Mouse)
UseSubcloning and sequencingTagsExpressionMutationN/APromoterAvailable sinceMarch 21, 2011AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 6xUTR
Plasmid#40761PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsert6 copies of the CXCR4 small RNA target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 2xUTR
Plasmid#40757PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsert2 copies of the CXCR4 small RNA target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 4xUTR
Plasmid#40759PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsert4 copies of the CXCR4 small RNA target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 5xUTR
Plasmid#40760PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsert5 copies of the CXCR4 small RNA target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1xUTR
Plasmid#40756PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
pJZC116
Plasmid#62344PurposesgRNA + 2x MS2(wt+f6) with MCP-VP64 effector for mammalian cells, marked by BFPDepositorInsertssgRNA + 2x MS2 (wt+f6) binding module
MCP-VP64
UseLentiviralTagsVP64ExpressionMammalianMutationTargets CXCR4 , sequence: GCAGACGCGAGGAAGGAGGGCGCPromoterCMV and U6Available sinceApril 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Control(1))-PGKpuro2AmCherry-W
Plasmid#210612PurposeLentiviral vector expressing gRNA targeting a control region at the CXCR4 locusDepositorInsertControl(1)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pKLV2-U6gRNA5(Control(2))-PGKpuro2AmCherry-W
Plasmid#210613PurposeLentiviral vector expressing gRNA targeting a control region at the CXCR4 locusDepositorInsertControl(2)
UseLentiviralTagsExpressionMutationPromoterAvailable sinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to bulged siRNA
Plasmid#40765PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to bulged target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceDec. 18, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed siRNA
Plasmid#40766PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
mutpRL-TK 1x perfect to seed plus 13-16 siRNA
Plasmid#40767PurposeTo evaluate the efficacy of silencing and the extent of cooperativity directed by a small silencing RNA bound at one or multiple sites on an mRNADepositorInsertCXCR4 small RNA perfect to seed plus 13-16 target site
UseLuciferaseTagsluciferaseExpressionMutationmutated from TAG to CTC at nt 387–389 of the Reni…PromoterTKAvailable sinceSept. 26, 2013AvailabilityAcademic Institutions and Nonprofits only -
FFA1-Tango
Plasmid#66280PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorInsertFFA1 (FFAR1 Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
GPR84-Tango
Plasmid#66377PurposeExpression of G protein-coupled receptors for PRESTO-Tango: parallel receptorome expression and screening via transcriptional output, with transcriptional activation following arrestin translocationDepositorInsertGPR84 (GPR84 Human)
UseTagsFLAGExpressionMammalianMutationPromoterCMVAvailable sinceSept. 15, 2015AvailabilityAcademic Institutions and Nonprofits only -
GPR84-DuET
Plasmid#213292PurposeThe DuET construct encodes the named human GPCR engineered with a cleaved hemagglutinin signal peptide, a 5' FLAG and a 3' 1D4 epitope tag optimized for expression in mammalian cells and proteomics studies.DepositorInsertGPR84 (GPR84 Human)
UseTags1D4 and FLAGExpressionMammalianMutationPromoterCMV, T7Available sinceApril 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-CNOT6
Plasmid#221288PurposeExpression of CNOT6 (pLxIS) in mammalian cells by retroviral transductionDepositorInsertCNOT6 (pLxIS) (Cnot6 Mouse)
UseRetroviralTagsFLAG-4xFKBPExpressionMutationPromoterAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
Opto-GPR84
Plasmid#106036PurposeExpression of a chimeric G-protein coupled receptor (Rhodopsin-GPR84; Opto-GPR84; D2)DepositorInsertOpto-GPR84 (GPR84 Bovine, Human)
UseTagsRhodopsin-1D4 and VSV-GExpressionMammalianMutationChimeric receptor proteinPromoterCMVAvailable sinceJan. 23, 2019AvailabilityAcademic Institutions and Nonprofits only -
phBG-P53DD
Plasmid#149707PurposeIn vitro transcription of dominant negative form of P53 mRNA for RNA transfection into mammalian cellsDepositorInsertTrp53 (Trp53 Mouse)
UseRna transcriptionTagsExpressionMutationdeleted amino acid 14-301PromoterT7Available sinceJune 24, 2020AvailabilityAcademic Institutions and Nonprofits only