We narrowed to 19,308 results for: cat
-
Plasmid#210350PurposeExpresses REEP5 fused with 2Strep in mammalian cellsDepositorAvailable SinceDec. 19, 2023AvailabilityAcademic Institutions and Nonprofits only
-
LentiCRISPRv2-sgCD20
Plasmid#209749PurposeLentiviral transfer plasmid to express Cas9 and a gRNA targeting the human CD20 gene, MS4A1.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-SNRNP70_sgRNA1
Plasmid#201620PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertSNRNP70 (SNRNP70 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
LENTICRISPR-SNRNP70_sgRNA2
Plasmid#201621PurposeCRISPR/Cas9-mediated gene knock-outDepositorInsertSNRNP70 (SNRNP70 Human)
UseCRISPR and LentiviralAvailable SinceJune 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
4A3.PBAD-repL(AT2).J23115-gfp
Plasmid#197873PurposeArabinose induced expression of repL(AT2) gene, which triggers DNA replication in trans, weak level of constitutive GFP expressionDepositorInsertpart kilA/repL(AT2)
ExpressionBacterialPromoterPBADAvailable SinceJune 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
Lenti-guide-puro mAtp5c-2
Plasmid#198480Purposelentiviral stable expression of mAtp5c gRNA 2DepositorAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFAK #1
Plasmid#198757Purposeconditional knockdown of FAKDepositorInsertshFAK #1 (PTK2 Human)
ExpressionMammalianAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Teton-puro-shFAK #2
Plasmid#198758Purposeconditional knockdown of FAKDepositorInsertshFAK #2 (PTK2 Human)
ExpressionMammalianAvailable SinceApril 21, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEN-CAG-mRFP-PCNA pc2729
Plasmid#166040PurposeExpresses mRFP tagged human PCNA in mammalian cells.DepositorAvailable SinceMarch 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX459_V2.0_pSpCas9(BB)-2A-Puro_T-REX17_Ex1_KI
Plasmid#195504PurposeCas9-2A-Puro expression vector bearing a sgRNA targeting Exon 1 of human lncRNA T-REX17DepositorInsertsgRNA
UseCRISPRTags3XFLAG, Puro, and T2AExpressionMammalianPromoterU6Available SinceFeb. 22, 2023AvailabilityAcademic Institutions and Nonprofits only -
FUG-P2A-tC3-W
Plasmid#129475Purpose3rd-generation lentiviral vector for hUbC-driven co-expression of EGFP and truncated C3DepositorInserttruncated (AA173-201) exoenzyme C3 from C. botulinum, P2A, EGFP
UseLentiviralExpressionMammalianPromoterhuman ubiquitin CAvailable SinceFeb. 14, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAV-U6-DR30(sapI)-CMV-intron-hfCas13d-pA
Plasmid#195865PurposeTo express hfCas13dDepositorInserthigh fidelity (hf) version of CasRx (hfCas13d)
UseAAVMutationYes: GTGGAATACATTACCAACGTGGTGTACGTGPromoterCMVAvailable SinceJan. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pSilencer2.1-U6-3JB1R+6
Plasmid#190842PurposeFor mammalian expression of 3JB1R+6, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1R_AP3+6bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-4JC1RR
Plasmid#190847PurposeFor mammalian expression of 4JC1RR, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert4JC1RR (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-LRS1F50C
Plasmid#190856PurposeFor mammalian expression of LRS1F50C, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer is regulated by riboswitch elements.DepositorInsertLRS1F50C (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-T1-U6-AP3
Plasmid#190828PurposeFor mammalian expression of T1 and AP3, the RNA aptamers of ncOGT and GFP, respectively. Expression of each aptamer is driven by a U6 promoter.DepositorInsertsT1 (an RNA aptamer of OGT)
AP3 (an RNA aptamer of GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-NL1F35
Plasmid#190830PurposeFor mammalian expression of NL1F35, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a flexible linker.DepositorInsertNL1F35 (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-NL1F50
Plasmid#190831PurposeFor mammalian expression of NL1F50, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a flexible linker.DepositorInsertNL1F50 (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1F+2
Plasmid#190833PurposeFor mammalian expression of 3JB1F+2, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1F_T1+2bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
pSilencer2.1-U6-3JB1F+6
Plasmid#190835PurposeFor mammalian expression of 3JB1F+6, a dual-specificity aptamer that binds OGT and GFP. Expression is driven by a U6 promoter. This dual-specificity aptamer adopts a folded linker.DepositorInsert3JB1F_T1+6bp (A Dual-Specificity aptamer targeting OGT and GFP)
UseAffinity Reagent/ Antibody and Synthetic BiologyExpressionMammalianPromoterU6Available SinceJan. 9, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits