We narrowed to 69,960 results for: TOR;
-
Plasmid#188346PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a (GGS)12, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_(GGS)12_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_(GGS)15_SNIPR
Plasmid#188347PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a (GGS)15, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_(GGS)15_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_(GGS)18_SNIPR
Plasmid#188348PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a (GGS)18, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_(GGS)18_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_3xFLAG-tag tether
Plasmid#188352PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a 3X-FLAG-ECD, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_3X-FLAG-ECD_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_Notch2 del-NRR
Plasmid#188354PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a Notch2-del-NRR-ECD, a Notch2-TMD, a Notch2-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_Notch2-NRRdeletion-ECD_Notch2-TMD_Notch2-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_Notch3 del-NRR
Plasmid#188355PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a Notch3-del-NRR-ECD, a Notch3-TMD, a Notch3-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_Notch3-NRRdeletion-ECD_Notch3-TMD_Notch3-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_IgG4 SNIPR
Plasmid#188359PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a IgG4-ECD, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_IgG4-ECD_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_OX40 SNIPR
Plasmid#188360PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a OX40-ECD, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_OX40-ECD_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pHR_PGK_SNIPR_CD8alpha variant 3
Plasmid#188363PurposeLentiviral vector - constitutive expression of an anti-CD19 SNIPR with a CD8alpha-variant3-ECD, a Notch1-TMD, a Notch1-JMD, and a Gal4VP64 transcriptional factorDepositorInsertPGK_antiCD19_CD8alpha-variant3-ECD_Notch1-TMD_Notch1-JMD_Gal4VP64
UseLentiviralAvailable SinceMarch 9, 2023AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::HA-RfA
Plasmid#186404PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter HA tag and a gene of interest under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceNov. 10, 2022AvailabilityAcademic Institutions and Nonprofits only -
pET28-MBP-CI2F
Plasmid#191254PurposeExpresses chymotrypsin inhibitor with an N-terminal MBP fusion proteinDepositorInsertChymotrypsin Inhibitor 2
TagsMaltose Binding ProteinExpressionBacterialAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::HA-RfA
Plasmid#186411PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion N-ter HA tag-gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::venus-RfA
Plasmid#186408PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter Venus under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceOct. 4, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-CFP
Plasmid#186412PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter CFP under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA-ECFP
Plasmid#186402PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter eCFP under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::venus-RfA
Plasmid#186398PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pPBO.ACT004
Plasmid#182714PurposeConstituitvely expressed CasRx crRNA cloning vector, extended 3' terminator regionDepositorInsertCasRx crRNA cloning backbone
UseCRISPRExpressionBacterialMutationCatalytically deactivated R295A, H300A, R849A, H8…PromoterpJ23119 (TTGACAGCTAGCTCAGTCCTAGGTATAATACTAGT)Available SinceAug. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA-HA
Plasmid#186405PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter HA tag under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-venus
Plasmid#186409PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion N-ter Venus-gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-HA
Plasmid#186410PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter HA tag under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only