We narrowed to 18,353 results for: multi
-
Plasmid#38009DepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertsExpressionBacterial and MammalianPromoterCMVAvailable sinceJan. 20, 2016AvailabilityAcademic Institutions and Nonprofits only
-
Cenp-B DBD INCENP TSS/AAA mCherry
Plasmid#45234PurposeTarget INCENP (with TSS mutated to AAA) to centromeres via CENP-B DNA binding domain (DBD)DepositorInsertCenp-B DBD, INCENP-ΔCEN with AAA mutation, mCherry
TagsCENP-B DBD, DNA binding domain of CENP-B and mChe…ExpressionMammalianMutationINCENP C-terminal TSS mutated to AAAPromotert7Available sinceSept. 4, 2014AvailabilityAcademic Institutions and Nonprofits only -
pJH104
Plasmid#48262PurposeTemplate plasmid for PCR-based transplant of Saccharomyces cerevisiae TEF1 promoter in yeast.DepositorInsertsTEF1p 5' fragment
URA3 5' fragment
TEF1p 3' fragment
UseRoutine cloning vectorMutationFrom SK1 background. -343 to -1 relative to TEF1 …PromoterTEF1pAvailable sinceFeb. 10, 2014AvailabilityAcademic Institutions and Nonprofits only -
pU6_rd6_nsgRNA(PP7)
Plasmid#232434PurposensgRNA for PE3b correction of the rd6 mutation, contains a PP7 in the scaffold tetraloopDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertPP7-tagged nicking gRNA (PE3b) for rd6 correction driven by human U6 promoter
UseCRISPRPromoterU6Available sinceApril 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
pONL-N1_PTS2
Plasmid#65677PurposeExpresses PTS2-ONL in mammalian cellsDepositorInsertperoxisomal targeting signal 2
UseLuciferaseTagsONLExpressionMammalianPromoterCMVAvailable sinceJune 9, 2015AvailabilityAcademic Institutions and Nonprofits only -
pET28-a(+)-6xHis-miRFP(-5)-HO1
Plasmid#219424PurposeFluorescent protein to reconstruct the mixture that mimics the charge profile of E. coli lysateDepositorInsertsmiRFP682
HO1
TagsMGHHHHHGGExpressionBacterialMutationContains Ribosomal Binding Site for expression of…PromoterT7Available sinceOct. 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLiP-G2-RacE
Plasmid#188966PurposeL-Rhamnose inducible catalytically inactive Cas9 with sgRNA and racE gene for bacterial gene knockdownDepositorInsertsdCas9
sgRNA: gttagacgctgattacatggactagg
racE
UseSynthetic BiologyExpressionBacterialPromoterPrhaBADAvailable sinceSept. 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
hCMV-IE1:MetLuc:bgH
Plasmid#135292PurposeTranscriptional unit for constitutive expression of MetLuc in mammalian cellsDepositorInsertCMV:MetLuc:bGH
UseLuciferase and Synthetic BiologyExpressionMammalianAvailable sinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTK-EdnrbE2-Sox10-FLAG-tev-AVI
Plasmid#127775PurposeModified pTK plasmid containing chicken EdnrB E2 enhancer driving expression of full length Chicken Sox10 in frame with a Flag-tag and Avi-tagDepositorAvailable sinceJan. 13, 2020AvailabilityAcademic Institutions and Nonprofits only -
pONL-N1_zyxin
Plasmid#65683PurposeExpresses Zyxin-ONL in mammalian cellsDepositorAvailable sinceJuly 20, 2015AvailabilityAcademic Institutions and Nonprofits only -
pONL-N1_TUBB5
Plasmid#65680PurposeExpresses beta-tubulin-ONL in mammalian cellsDepositorInsertbeta-tubulin class V
UseLuciferaseTagsONLExpressionMammalianPromoterCMVAvailable sinceJune 18, 2015AvailabilityAcademic Institutions and Nonprofits only -
pDisplay-GRAB-HaloDAmut-IRES-EGFP-CAAX
Plasmid#234411PurposeExpresses the chemigenetic dopamine (DA) control sensor GRAB_HaloDAmut and a membrane-localized EGFP in mammalian cellsDepositorHas service50 µg Transfection-Ready DNA and 100 µg Transfection-Ready DNAInsertGPCR activation based chemigenetic dopamine (DA) control sensor GRAB_HaloDAmut
ExpressionMammalianPromoterCMVAvailable sinceJune 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMRX-IP-EGFP-PA-BAX(ER)
Plasmid#228941PurposeStable expression of EGFP-LOV2(N538E)-BAX-Cyb5a in mammalian cells. Photoactivatable BAX localizes on ER and induces ER rupture upon blue light stimulation.DepositorUseRetroviralTagsEGFPExpressionMammalianMutationN538E, N-terminus and C-terminus are deleted. BAX…Available sinceApril 28, 2025AvailabilityAcademic Institutions and Nonprofits only -
MT-AvrXa10-FT
Plasmid#234373PurposeT-DNA vector for expression of the two protein components of the MoonTag system (dCas9-24XGP41 and NbGP41P-GFP-AvrXa10-GB1) with optimized activation domain (AvrXa10), targeting Arabidopsis FT locusDepositorInsertsNbGP41-GFP-AvrXa10-GB1
dCas9-24XGP41
gRNAs targeting FT locus
RFP
UseSynthetic BiologyTagsGB1, GFP, and GP41ExpressionPlantPromoterArabidopsis U6, Arabidopsis Ubi10, and Arabidopsi…Available sinceApril 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTMiniTrex-mCherry-Shark2
Plasmid#233144PurposeServes as a template plasmid for amplifying Shark2 (Tet-ON) hammerhead aptazyme-3xTy-tagging cassetteDepositorInsertsmCherry
Shark2
UseProkaryotic expressionTags3x Ty tagMutationCodon optimized for Trypanosoma cruziAvailable sinceMarch 20, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pTol2-fli1-lsl-AmCyan-mScarlet; hsp70-zfCre-I-BFP (JDW 1234)
Plasmid#229810PurposeA Tol2 based expression vector containing fli1 driven switch reporter (loxP flanked AmCyan followed by a mScarlet-I) and a hsp70-TagBFP-zCre in the opposite direction.DepositorInsertloxp-AmCyan-stop-lox
UseTol2 based expression vectorAvailable sinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
EF1α-TetOn3G_2x cHS4_pTRE3G-loxP-EGFP-lox2272 [C12orf35]
Plasmid#227245PurposeAll-in-one ROSE LP donor construct for TetOn3G-inducible cell line development in CHO cellDepositorInsertsTet-On 3G transactivator protein
Enhanced green fluorescent protein
UseCre/Lox and Synthetic BiologyExpressionMammalianPromoterEF1α and pTRE3GAvailable sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRSFDuet-FBXL5-SKP1
Plasmid#226620PurposeCo-expression of FBXL5-SKP1 complex in E.coliDepositorTagsGB1ExpressionBacterialMutationAmino acids 1-198 was deleted, and 420-596 was re…PromoterT7Available sinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
pQ-Elo-HB-C-A(1-772)
Plasmid#171085PurposeCo-expresses of WT-ELOA containing Elongin complex in bacteria. The resulting plasmid was used to generate a single expression construct encoding all 3Elongin subunits, with a 6-His tag on ELOBDepositorTagsHisExpressionBacterialMutationDeleted N-term 26 amino acids for expression purp…PromoterT5 promoterAvailable sinceJuly 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLV-REPORT(PGK/CMV)-GtwyA
Plasmid#208574PurposeLV REPORT containing minimal promoter (GtwyA inserted into MCS) driving monomeric nuclear Tomato followed by an PKG/CMV promoter driving nuclear d2eGFP E2A HygromycinDepositorPublicationInsertsmnucTomato
HSVtk
Neomycin
d2nucEGFP
UseLentiviral and Synthetic BiologyExpressionMammalianPromoterPGK/CMV and minPAvailable sinceApril 25, 2024AvailabilityAcademic Institutions and Nonprofits only