We narrowed to 24,635 results for: crispr
-
Plasmid#180011PurposeDonor for generating conditional alleles in zebrafish using precise CRISPR directed genomic integration with the GeneWeld methodDepositorInsert2A-KalTA4; HE1A: BFP
UseSynthetic BiologyAvailable SinceFeb. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJJGL002
Plasmid#180606PurposePlasmid expressing E. coli codon optimized His-MBP-TEV-PlmCasXDepositorInsertPlmCasX
UseCRISPRTags10xHis and MBPExpressionBacterialPromoterT7Available SinceApril 25, 2022AvailabilityAcademic Institutions and Nonprofits only -
qTAG-N-Puro-moxGFP-TUBA1B
Plasmid#207767PurposeDonor template for Puro-2A-moxGFP insertion into the N-terminus of the TUBA1B locus for tubulin visualization. To be co-transfected with sgRNA plasmid px330-PITCh-TUBA1B Addgene #207763DepositorInsertTUBA1B Homology Arms flanking a Puro-moxGFP Cassette (TUBA1B Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 15, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
Cas12f-GE ver3.0
Plasmid#176508PurposeExpresses Cas12f-GE in mammalian cellsDepositorInsertsCas12f-GE ver3.0
Cas12f-GE ver3.0
ExpressionMammalianPromoterU6 and chicken β-actinAvailable SinceOct. 18, 2021AvailabilityAcademic Institutions and Nonprofits only -
pC009 LshCas13a locus with targeting spacer
Plasmid#91900PurposeLshCas13a locus into pACYC184 with targeting spacerDepositorInsertLshCas13a locus with targeting spacer
ExpressionBacterialAvailable SinceOct. 16, 2017AvailabilityIndustry, Academic Institutions, and Nonprofits -
qTAG-N-Blast-3xFLAG-LMNB1
Plasmid#207777PurposeDonor template for Blast-2A-3xFLAG insertion into the N-terminus of the LMNB1 locus. To be co-transfected with sgRNA plasmid px330-PITCh-LMNB1 Addgene #207770DepositorInsertLMNB1 Homology Arms flanking a Blast-3xFLAG Cassette (LMNB1 Human)
UseCRISPR; Donor templateExpressionMammalianAvailable SinceNov. 29, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits -
3xNLS-NLP-cMyc-cMyc LbaCas12a
Plasmid#182125PurposepET21a protein expression vector for 3xNLS-NLP-cMyc-cMyc LbaCas12a in bacteriaDepositorInsert3xNLS-NLP-cMyc-cMyc LbaCas12a
Tags6xHisExpressionBacterialPromoterT7Available SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJEP14-AAV-H1/TO-sgRNA(Empty)-CMV-TetR-P2A-eGFP-KASH-pA
Plasmid#82702PurposeAAV backbone with a minimal H1/TO promoter driving expression of a sgRNA. The gRNA can be inserted via Sapl. TracrRNA compatible with SpCas9. gRNA transcription is doxycycline dependent.DepositorInsertH1/TO Empty gRNA Expression Cassette
UseAAV and CRISPRTagsCMV promoter driving expression of TetR-P2A-GFP-K…ExpressionMammalianAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7820 pHR (hU6-crPURI-EFS-PuroR-WPRE)
Plasmid#214883PurposeLentiviral vector encoding RfxCas13d targeting PURI guide arrayDepositorInserthU6-crPURI-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ7854 pHR (hU6-crGLY-EFS-PuroR-WPRE)
Plasmid#214884PurposeLentiviral vector encoding RfxCas13d targeting GLY guide arrayDepositorInserthU6-crGLY-EFS-PuroR-WPRE
UseCRISPR and LentiviralExpressionMammalianPromoterhU6Available SinceApril 4, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRI004-pYFAC-riboB-PgpdA-dLbCas12a-VPR-TtrpC
Plasmid#140197PurposeEpisomal expression of dLbCas12a-VPR. Filamentous fungi vector with AMA1 and riboB selection marker.DepositorInsertdLbCas12a-VPR
UseCRISPR and Synthetic Biology; Expression in asper…TagsVPR (VP64-p65-Rta), NLSMutationD832A DNase deactivatedPromoterPgpdAAvailable SinceSept. 2, 2020AvailabilityAcademic Institutions and Nonprofits only -
pETM6-4F2-mCherry
Plasmid#73421PurposeReporter plasmid encoding mCherry, codon optimized for E. coli, transcriptionally driven by orthogonal T7-lac promoter variant 4F2.DepositorInsertPromoter 4F2 (orthogonal T7-lac variant)
UseCRISPR and Synthetic BiologyExpressionBacterialPromoterP4F2 (orthogonal T7-lac variant)Available SinceMarch 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BsaI)_CBh-Cas9-T2A-mCherry
Plasmid#135012PurposeExpression vector for sgRNAs cloned into the BsaI sites and for expression of Cas9 linked to mCherry via a T2A peptideDepositorInserthumanized S. pyogenes Cas9
Tags3x Flag, 3xFLAG (N terminal on insert), NLS, and …ExpressionMammalianPromoterCBhAvailable SinceJan. 3, 2020AvailabilityAcademic Institutions and Nonprofits only -
pNOC_hfnCas12a_Nlux_(-HH)crRNA NR1
Plasmid#176250PurposepNOC episomal plasmid harboring the humanized fnCas12a gene sequence tagged with Nlux and crRNA targeting the Nitrate reductase gene of N. oceanica IMET1 with spacer 1 without the hammerhead ribozymDepositorInserthumanized fnCas12a
UseCRISPR and Synthetic Biology; Expression in micro…Available SinceNov. 16, 2021AvailabilityAcademic Institutions and Nonprofits only -
p426_Cas9_gRNA-ARS416d
Plasmid#87386PurposeAll-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.DepositorInsertHuman Optimized S. pyogenes Cas9 and guide RNA targeting ARS416d
UseCRISPRPromoterADH1, pTyrosineAvailable SinceApril 5, 2017AvailabilityAcademic Institutions and Nonprofits only -
qTAG-C-Solo-mStayGold-PEX3
Plasmid#227304PurposeDonor template for mStayGold insertion into the C-terminus of the PEX3 locus. For peroxisome visualization. To be co-transfected with sgRNA plasmid px330-PITCh-PEX3 (Addgene #227303)DepositorInsertPEX3 Homology Arms flanking a mStayGold Tag (PEX3 Human)
UseCRISPR; Donor templateExpressionMammalianPromoterPromoterlessAvailable SinceNov. 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCas9-T2A-mApple
Plasmid#193780PurposeTricistronic expression of Cas9-mApple-BSD in mammalian cellsDepositorInsertmApple
UseLentiviralExpressionMammalianPromoterIn frame with Cas9Available SinceMay 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
plenti-px330-CRBN-T2-pGK-Pur
Plasmid#107383PurposeMammalian expression CRISPR/Cas9DepositorAvailable SinceJune 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
pBZCas13b-HEPN
Plasmid#89901PurposeBacterial expression for bzCas13b and crRNA with both HEPN domains mutated. New spacers can be cloned by digesting with BsaI.DepositorInsertCas13b
ExpressionBacterialMutationR116A/H121A/R1177A/H1182APromoterLacAvailable SinceMay 12, 2017AvailabilityAcademic Institutions and Nonprofits only -
pEJS1005-Lenti-mammalian c.o.AcrIIA5-FLAG-NLS-HygR
Plasmid#136514PurposeExpresses type II-A anti-CRISPR protein AcrIIA5 in mammalian cells in a lentiviral vectorDepositorInsertCodon-optimized AcrIIA5
UseLentiviralTagsFLAG/NLSExpressionMammalianPromoterSFFVAvailable SinceFeb. 11, 2020AvailabilityAcademic Institutions and Nonprofits only