We narrowed to 17,507 results for: shRNA
-
Plasmid#76214Purpose3rd generation lentiviral gRNA plasmid targeting human NEK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only
-
CAMK1 gRNA (BRDN0001145955)
Plasmid#77476Purpose3rd generation lentiviral gRNA plasmid targeting human CAMK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCLK2 gRNA (BRDN0001145364)
Plasmid#75698Purpose3rd generation lentiviral gRNA plasmid targeting human DCLK2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
DCLK1 gRNA (BRDN0001147487)
Plasmid#76747Purpose3rd generation lentiviral gRNA plasmid targeting human DCLK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB2 gRNA (BRDN0001147469)
Plasmid#77546Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB2 gRNA (BRDN0001147792)
Plasmid#77547Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB2 gRNA (BRDN0001147198)
Plasmid#77548Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001144879)
Plasmid#76352Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
EPHB4 gRNA (BRDN0001148436)
Plasmid#76353Purpose3rd generation lentiviral gRNA plasmid targeting human EPHB4DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-8
Plasmid#129048Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA8 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA8 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-hudTET1CD-T2A-mCherry(PX458)-SghuTSDR-1
Plasmid#129041Purposeinactivated control (targeted DNA demethylation_human_TSDR), expression of dCas9-hudTET1CD-T2A-mCherry sgRNA1 targeting human TSDRDepositorInsertdCas9-hudTET1CD, SgRNA1 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A), catalytic domain huTET1 inact…PromoterCbH (for dCas9-hudTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
pSpdCas9-huTET1CD-T2A-mCherry(PX458)-SghuTSDR-8
Plasmid#129036Purposetargeted DNA demethylation_human_TSDR, expression of dCas9-huTET1CD-T2A-mCherry and sgRNA8 targeting human TSDRDepositorInsertdCas9-huTET1CD, SgRNA8 (huTSDR)
TagsHA-Tag, NLS and T2A-mCherryExpressionMammalianMutationdCas9 (D10A;H840A)PromoterCbH (for dCas9-huTET1CD-T2A-EGFP) U6 (for sgRNA)Available SinceJan. 25, 2021AvailabilityAcademic Institutions and Nonprofits only -
PRKAA2 gRNA (BRDN0001148583)
Plasmid#76634Purpose3rd generation lentiviral gRNA plasmid targeting human PRKAA2DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
CDK6 gRNA (BRDN0001147855)
Plasmid#75645Purpose3rd generation lentiviral gRNA plasmid targeting human CDK6DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
JAK3 gRNA (BRDN0001145049)
Plasmid#77190Purpose3rd generation lentiviral gRNA plasmid targeting human JAK3DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
MARK1 gRNA (BRDN0001149474)
Plasmid#77793Purpose3rd generation lentiviral gRNA plasmid targeting human MARK1DepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 1-exon 1
Plasmid#163320PurposeSpCas9 ILK gRNA 1 (G*CGGAGAACGACCTCAACCAG), targeting exon 1 within the N-terminal ankyrin repeat domain-1.DepositorInsertILK gRNA 1_Exon1
UseCRISPRExpressionMammalianPromoterU6Available SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
PX459v2-ILK-gRNA 2-exon 8
Plasmid#163321PurposeSpCas9 ILK gRNA 2 (G*ACATTGTAGAGGGATCCATA), targeting exon 8 within the C-terminal protein kinase domain.DepositorInsertILK gRNA 2_Exon8
UseCRISPRExpressionMammalianPromoterU6FAvailable SinceJan. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
BTK gRNA (BRDN0001146090)
Plasmid#77073Purpose3rd generation lentiviral gRNA plasmid targeting human BTKDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only -
LYN gRNA (BRDN0001148376)
Plasmid#77026Purpose3rd generation lentiviral gRNA plasmid targeting human LYNDepositorAvailable SinceJuly 6, 2016AvailabilityAcademic Institutions and Nonprofits only