We narrowed to 17,226 results for: REV

#197845

Donor vector to restore L1 destination via Esp3I (reverse orientation)

Daniel Voytas

Chamness et al Plant Genome. 2023 Mar 9:e20312. doi: 10

May 11, 2023

Academic Institutions and Nonprofits only

#189718

titratable expression of PAmCherry1 in bacteria

Daniel Daley

Shilling et al Synth Biol (Oxf). 2022 Jul 5;7(1):ysac00

Nov. 8, 2022

Academic Institutions and Nonprofits only

#189722

titratable expression of mNeonGreen in bacteria

Daniel Daley

Shilling et al Synth Biol (Oxf). 2022 Jul 5;7(1):ysac00

Oct. 4, 2022

Academic Institutions and Nonprofits only

#177528

Mammalian Expression Plasmid of anti-Brevican (Rat). Derived from hybridoma N294A/10R.

James Trimmer

Mitchell et al Sci Rep. 2023 Sep 27;13(1):16200. doi: 1

Dec. 10, 2021

Academic Institutions and Nonprofits only

#136016

The Reverse Complement of EIF3B 3'UTR inserted into the 3'UTR of Renilla luciferase in the psiCHECK3 plasmid

Anthony Leung

Fischer et al Mol Cell. 2020 Apr 2;78(1):70-84.e6. doi

Feb. 4, 2020

Academic Institutions and Nonprofits only

#240107

A lentiviral (red) fluorescent reporter of circadian rhythm, based on the murine Nr1d1-gene (REVERBa protein), expression enhanced by synthtic JeT promoter.

Achim Kramer

Gabriel et al bioRxiv 2025.06.30.661926

Aug. 4, 2025

Academic Institutions and Nonprofits only

#48305

Scott Gradia

Nov. 5, 2013

Academic Institutions and Nonprofits only

#159607

Constitutive transient mammalian expression of m6A-Tracer protein (Kind et al. 2013) with a C-terminal HIV-1 Rev Nuclear Export Signal to reduce background due to nonspecific DNA interactions.

Aaron Streets

Altemose et al Cell Syst. 2020 Oct 21;11(4):354-366.e9.

Sept. 25, 2020

Academic Institutions and Nonprofits only

#207095

pX330 based plasmid for expression of Cas9 and the GCTCATAAAGGCAGCTGAGG sgRNA to target the REV7 locus.

Jens Schmidt

Heyza et al Elife. 2023 Jun 21;12:e87086. doi: 10.75

May 1, 2025

Academic Institutions and Nonprofits only