We narrowed to 5,962 results for: crispr cas9 expression plasmids
-
Plasmid#121823PurposepMAGIC R4-R3 entry plasmid, contains 2x NLS Sa-dCas9 fused to the KRAB transcriptional repressor for 3 or 4-component MultiSite Gateway Pro assembly.DepositorInsertSa-dCas9/KRAB (open)
UseSynthetic Biology; Pmagic gateway entry plasmidTagsNLSAvailable SinceJune 27, 2019AvailabilityAcademic Institutions and Nonprofits only -
pAAV-pCALM1-sFLEx-HA-SpCas9-miniU6-sgRNAShank3
Plasmid#213969PurposeAAV vector for encoding SpCas9 driven by pCALM1 promoter targeting Shank3 locus in the presence of Cre recombinaseDepositorInsertShank3 sgRNA
UseAAV and CRISPRAvailable SinceMay 15, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-seq2
Plasmid#240865PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV- GfaABC1D::Cas9-HA-sgRNA-Ezr-Seq1
Plasmid#240094PurposeGfaABC1D promoter driven HA-tagged SaCas9 together with U6 driven expression of sgRNA targeting exon-1 of mouse Ezrin; for knocking-out ezrin in murine astrocytesDepositorInsertU6 driven sgRNA Targeting exon 1 of EZR (Ezr Mouse)
UseAAV and CRISPRTagsSaCas9 + 3X HA-TagExpressionMammalianPromoterGfaABC1DAvailable SinceAug. 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
hCas9-VPR
Plasmid#68497Purposenuclease competent SP-Cas9 fused to VPRDepositorInsertSP-Cas9-VPR
TagsVPRExpressionMammalianPromoterCMVAvailable SinceSept. 8, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9_gRNA1TERTKO_BsagRNA5tertko_2A-GFP
Plasmid#198863PurposePlasmid encoding for 2 gRNAs targeting the human TERT geneDepositorAvailable SinceApril 26, 2023AvailabilityAcademic Institutions and Nonprofits only -
pX603-AAV-CMV::NLS-dSaCas9(D10A,N580A)-NLS-3xHA-bGHpA
Plasmid#61594PurposeA catalytically inactive SaCas9 (dSaCas9) with the D10A and N580A mutations.DepositorInserthSaCas9
UseAAV and CRISPRTags3xHA and NLSExpressionMammalianMutationD10A, N580AAvailable SinceJuly 27, 2015AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(2)
Plasmid#136059PurposeG3BP1 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTATTACACACTGCTGAACC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP1(1)
Plasmid#136058PurposeG3BP1 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (GTAGTCCCCTGCTGGTCGGGC)DepositorInsertG3BP1 (G3BP1 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(1)
Plasmid#136060PurposeG3BP2 gRNA (#1) inserted into the pSpCas9(BB)-2A-GFP plasmid (TCATACTAAAATTCGTCATG)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceApril 24, 2020AvailabilityAcademic Institutions and Nonprofits only -
pSpCas9(BB)-2A-GFP-G3BP2(2)
Plasmid#136061PurposeG3BP2 gRNA (#2) inserted into the pSpCas9(BB)-2A-GFP plasmid (GACAACTACTCCATCACTCA)DepositorInsertG3BP2 (G3BP2 Human)
ExpressionMammalianAvailable SinceFeb. 4, 2020AvailabilityAcademic Institutions and Nonprofits only -
pRS415-Cas9-VPR
Plasmid#163971PurposeTrifunctional Cas9-VPR fusion protein plasmid for simultaneous transcriptional activation, transcriptional repression, and genome editing in yeastDepositorInsertCas9-VPR
UseSynthetic BiologyExpressionYeastAvailable SinceFeb. 2, 2021AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.GFP
Plasmid#57818PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses eGFP via P2A cleavage site. EFS Promoter drivenDepositorInsertsUseCRISPR and LentiviralTagsFLAGPromoterEFS and hU6Available SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pL-CRISPR.EFS.tRFP
Plasmid#57819PurposeLentiviral CRISPR-Cas9 delivery for SpCas9 and sgRNA. Coexpresses tagRFP via P2A cleavage site. EFS Promoter drivenDepositorAvailable SinceAug. 20, 2014AvailabilityAcademic Institutions and Nonprofits only -
pBK2044-AAV-2xSp1-2xNFkB-EFSNC-dSaCas9-KRAB-MECP2
Plasmid#223164Purpose2nd gen. vector for expression of KRAB and truncated MECP2 with dSaCas9 and empty gRNA scaffoldDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1876-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA2)
Plasmid#223162PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA2 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pBK1861-AAV-EFSNC-dSaCas9-KRAB-MECP2(APOE-gRNA1)
Plasmid#223161PurposeExpression of KRAB and truncated MECP2 with dSaCas9 and gRNA1 targeting human/mouse APOEDepositorInsertKRAB-MECP2 (MECP2 Human)
UseAAV and CRISPRTags3xFLAGExpressionMammalianMutationEncodes aa 204-310 (MECP2)PromoterEF1aAvailable SinceAug. 22, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-nSpCas9(H840A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES140)
Plasmid#185490PurposeCMV and T7 promoter expression plasmid for human codon usage nSpCas9(H840A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFPDepositorInserthuman codon usage nSpCas9(H840A)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-eGFPExpressionMammalianMutationH840APromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCMV-T7-nSpCas9(D10A)-BPNLS(SV40)-3xFLAG-P2A-EGFP (HES24)
Plasmid#185492PurposeCMV and T7 promoter expression plasmid for human codon usage nSpCas9(D10A) with a C-terminal bi-partite NLS, 3x FLAG, and P2A-eGFPDepositorInserthuman codon usage nSpCas9(D10A)-BPNLS-P2A-eGFP
UseIn vitro transcription; t7 promoterTagsBPNLS-3xFLAG-P2A-eGFPExpressionMammalianMutationD10APromoterCMV and T7Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pCB-CRISPRi
Plasmid#221136PurposeCoxiella burnetii CRISPRi plasmid without sgRNA construct. Expresses 3xF-dCas9.DepositorInsert3xF-dCas9
UseCRISPRTags3xFLAGExpressionBacterialPromotercbu1169 promoterAvailable SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only