We narrowed to 42,313 results for: LIS

#79791

Insulin receptor isoform A with a inter-domain TagBFP tag at extracellular region (between furin-like domain and transmembrane domain). For imaging insulin receptor trafficing.

James Johnson

Boothe et al Mol Metab. 2016 Feb 10;5(5):366-78. doi:

Aug. 5, 2016

Industry, Academic Institutions, and Nonprofits

#68264

Level 1 Golden Gate Cassette: Cas9 expression cassette for plants (exemplified in Brassica oleracea)

Nicola Patron

Lawrenson et al Genome Biol. 2015 Nov 30;16(1):258. doi:

Aug. 20, 2015

Academic Institutions and Nonprofits only

#62460

expresses C151S and C288S double mutant human Keap1 protein

Yimon Aye

Parvez et al J Am Chem Soc. 2014 Dec 31.

March 21, 2017

Academic Institutions and Nonprofits only

#22689

William Kaelin

Miyake et al Mol Cell Biol. 2000 Dec . 20(23):8889-90

Dec. 3, 2009

Academic Institutions and Nonprofits only

#74515

Express GFP-nArgBP2ΔNSE fusion protein in mammalian cells. nArgBP2ΔNSE is the mutant without the neuronal specific exon of nArgBP2.

Guoping Feng

Zhang et al J Neurosci. 2016 Feb 17;36(7):2247-60. d

July 20, 2016

Academic Institutions and Nonprofits only

#87391

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting CAN1y sequence GATACGTTCTCTATGGAGGA in yeast chromosome 6.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87407

p425_Cas9_gRNA-ARS1014a All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, LEU2 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS1014a sequence TTATGTGCGTATTGCTTTCA in yeast chromosome 10.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#87404

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting YPRCd15c sequence AATCCGAACAACAGAGCATA in yeast chromosome 14.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only

#79797

Insulin receptor isoform A with a inter-domain EBFP2 tag at extracellular region (between furin-like domain and transmembrane domain). For imaging insulin receptor trafficing.

James Johnson

Boothe et al Mol Metab. 2016 Feb 10;5(5):366-78. doi:

Aug. 5, 2016

Industry, Academic Institutions, and Nonprofits

#87386

All-in-one CRISPR plasmid for integrating, deleting, or replacing a gene in S. cerevisiae. High-copy, URA3 plasmid contains human codon-optimized Cas9 and a guide RNA targeting ARS416d sequence TAGTGCACTTACCCCACGTT in yeast chromosome 4.

Aindrila Mukhopadhyay

Reider Apel et al Nucleic Acids Res. 2017 Jan 9;45(1):496-

April 5, 2017

Academic Institutions and Nonprofits only