We narrowed to 23,633 results for: ica;
-
Plasmid#239619PurposeshRNA-mediated knockdown of murine FosDepositorInsertshFos_2 (Fos Mouse)
UseLentiviralAvailable SinceJuly 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
pFUW LAMP1Sig-mEmerald
Plasmid#239555PurposeExpression and lysosomal localization of mEmeraldDepositorArticleInsertmEmerald
UseLentiviralPromoterUbCAvailable SinceJune 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_hSyn_NES-Kinprola_PKA-mEGFP_WRPE-SV40
Plasmid#233366PurposehSyn1 driven expression of the PKA activity recorder Kinprola_PKA fused to mEGFP for neuronal expression through AAV transductionDepositorInsertNES-Kinprola_PKA-mEGFP
UseAAVTagsNES and mEGFPPromoterhSyn1Available SinceJune 23, 2025AvailabilityAcademic Institutions and Nonprofits only -
pHIV-IL13-PDGFRStalk-TM
Plasmid#240243PurposeLentiviral transfer plasmid encoding IL-13 with PDGFR stalk and TM domainDepositorAvailable SinceJune 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
BtARR3 short (1-392)
Plasmid#236272PurposeBacterial expression of bovine arrestin-3 short (1-392) L393StopDepositorAvailable SinceMay 22, 2025AvailabilityAcademic Institutions and Nonprofits only -
SNX29-PX (269-391)
Plasmid#119108PurposeBacterial expression of human phox homology (PX) domain, SNX29-PX (269-391)DepositorInsertSNX29-PX (269-391)
TagsGSTExpressionBacterialPromotertacAvailable SinceMay 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
AiP14924 - pAAV-AiE0675m-minBG-iCre(297T)-BGHpA
Plasmid#233571PurposeAiE0675m is an enhancer sequence, designed to drive AAV-mediated transgene expression in specific populations of brain cellsDepositorInsertiCre(R297T)
UseAAVAvailable SinceMay 6, 2025AvailabilityAcademic Institutions and Nonprofits only -
RNF168 C-terminal sgRNA
Plasmid#207100PurposepX330 based plasmid for expression of Cas9 and the GAGATGCACAAAGTAAGGCC sgRNA to target the RNF168 locus.DepositorInsertGAGATGCACAAAGTAAGGCC
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
RIF C-terminal sgRNA
Plasmid#207096PurposepX330 based plasmid for expression of Cas9 and the AATACTAAATAGAATTTTCA sgRNA to target the RIF1 locus.DepositorInsertAATACTAAATAGAATTTTCA
ExpressionMammalianPromoterCMV and U6Available SinceMay 1, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-EGFP-APEX2-V5-EEA1
Plasmid#236403PurposeExpresses a fluorescent endosome-localized APEX2DepositorInsertEGFP-APEX2-V5-EEA1
UseRetroviralTagsAPEX2, EGFP, and V5ExpressionMammalianAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pQCXIP-EGFP-ADRP-APEX2-V5
Plasmid#236405PurposeExpresses a fluorescent lipid droplet-localized APEX2DepositorInsertEGFP-ADRP-APEX2-V5
UseRetroviralTagsAPEX2, EGFP, and V5ExpressionMammalianAvailable SinceApril 24, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CAG_Kinprola_PKA-mEGFP-NLS3__WPRE-SV40
Plasmid#233365PurposeCAG driven expression of the PKA activity recorder Kinprola_PKA fused to mEGFP for mammalian cell expression through AAV transductionDepositorInsertKinprola_PKA-mEGFP-NLS3X
UseAAVTagsmEGFP-NLS3XPromoterCAGAvailable SinceApril 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV_CAG_NES-Kinprola_PKA-mTagBFP2_WPRE-SV40
Plasmid#233364PurposeCAG driven expression of the PKA activity recorder Kinprola_PKA fused to mTagBFP2 for mammalian cell expression through AAV transductionDepositorInsertNES-Kinprola_PKA-mTagBFP2
UseAAVTagsNES and mTagBFP2PromoterCAGAvailable SinceMarch 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2TAL3-RR-zrif1_exon8
Plasmid#194434PurposeRight (RR) TALEN for mutating zebrafish rif1 geneDepositorAvailable SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pCS2TAL3-DD-zrif1_exon8
Plasmid#194435PurposeLeft (DD) TALEN for mutating zebrafish rif1 geneDepositorAvailable SinceJan. 13, 2025AvailabilityAcademic Institutions and Nonprofits only -
pLV-H1-shSRGAP2B/C#1-hsynapsin-EGFP
Plasmid#220796PurposeshRNA plasmid against human SRGAP2B/C genes (#1) with EGFP expression in neuronsDepositorInsertEGFP
Available SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-FKBP-TASL(FL)
Plasmid#221263PurposeExpression of TASL in mammalian cells by retroviral transductionDepositorAvailable SinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOCC240-MBP-Pab1-mCherry
Plasmid#219980PurposePab1p-mCherry protein purificationDepositorAvailable SinceJune 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
NBS1 C-terminal sgRNA
Plasmid#207092PurposepX330 based plasmid for expression of Cas9 and the TAAAAAGGAGAAGATAACTG sgRNA to target the NBS1 locus.DepositorInsertTAAAAAGGAGAAGATAACTG
ExpressionMammalianPromoterCMV and U6Available SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
ATM N-terminal sgRNA
Plasmid#207089PurposepX330 based plasmid for expression of Cas9 and the ATCATTAAGTACTAGACTCA sgRNA to target the ATM locus.DepositorInsertATCATTAAGTACTAGACTCA
ExpressionMammalianPromoterCMV and U6Available SinceApril 30, 2024AvailabilityAcademic Institutions and Nonprofits only