We narrowed to 23,293 results for: c-MYC
-
Plasmid#226276PurposePlasmid expressing the SEC18 allele from UWOPS87-2421, under control of its native promoterDepositorAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pRS313-SCT1-S288C
Plasmid#226266PurposePlasmid expressing the SCT1 allele from S288C, under control of its native promoterDepositorAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-L1374
Plasmid#226267PurposePlasmid expressing the SCT1 allele from L-1374, under control of its native promoterDepositorAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-LUG1
Plasmid#226265PurposePlasmid expressing Cas9 and gRNA TCTTCAAGTTACTCCAAGAG which targets the LUG1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-2
Plasmid#226263PurposePlasmid expressing Cas9 and gRNA GGTAGTGTTAGACCTGAACA which targets the LEU2 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-NCYC110
Plasmid#226269PurposePlasmid expressing the SCT1 allele from NCYC110, under control of its native promoterDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS313-SCT1-UWOPS872421
Plasmid#226268PurposePlasmid expressing the SCT1 allele from UWOPS87-2421, under control of its native promoterDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
TaraACR1-pmCherry-C1
Plasmid#204960PurposeExpression of TaraACR1 in fusion with mCherry in mammalian cellsDepositorInsertTaraACR1
UseTagsmCherryExpressionMammalianMutationPromoterCMV (+ enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
TaraACR2-pmCherry-C1
Plasmid#204961PurposeExpression of TaraACR2 in fusion with mCherry in mammalian cellsDepositorInsertTaraACR2
UseTagsmCherryExpressionMammalianMutationPromoterCMV (+ enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only -
TaraACR3-pmCherry-C1
Plasmid#204962PurposeExpression of TaraACR3 in fusion with mCherry in mammalian cellsDepositorInsertTaraACR3
UseTagsmCherryExpressionMammalianMutationPromoterCMV (+ enhancer)Available SinceOct. 25, 2023AvailabilityAcademic Institutions and Nonprofits only