We narrowed to 3,287 results for: PREP
-
Plasmid#234612PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) with 3 Gly and 1 Ser mutated to AsnDepositorInserthnRNPA1_LCD_4GSV (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationG204V, S231V, G274V, G303VPromoterT7Available SinceApril 15, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAG415Gal_Gcn4 ILVtoED solvvol
Plasmid#232958PurposeGalactose iduced expression of Gcn4 LVtoED solvvol in yeastDepositorInsertGcn4 ILVtoED solvvol
TagsTEV cleavage siteExpressionYeastMutationS101T, D103E, S104T, D115E, N116Q, S117T, S122T, …PromoterGal1Available SinceMarch 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
A1-LCD 5W D262V
Plasmid#234617PurposeBacterial expression of N-terminally 6His tagged hnRNPA1 LCD (186-320) D262V with partial W mutantDepositorInserthnRNPA1_LCD_5W D262V (HNRNPA1 Human)
Tags6xHis-TEVExpressionBacterialMutationF222W, F228W, Y237W, D262V, Y305W, F320WPromoterT7Available SinceMarch 10, 2025AvailabilityAcademic Institutions and Nonprofits only -
TMEM16F-I521A-peGFP-N1
Plasmid#228577PurposeExpresses mouse TMEM16F-I521A-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationI521A plus a 3 amino acid N-terminal truncation (…Available SinceDec. 11, 2024AvailabilityAcademic Institutions and Nonprofits only -
TMEM16F-I521E-peGFP-N1
Plasmid#228578PurposeExpresses mouse TMEM16F-I521E-eGFP in mammalian cellsDepositorInsertTMEM16F/anoctamin 6 (Ano6), transcript variant 2 (Ano6 Mouse)
ExpressionMammalianMutationI521E plus a 3 amino acid N-terminal truncation (…Available SinceDec. 2, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDEST17-DXO
Plasmid#177993PurposeFor purification of N-terminally His-tagged DXO from bacteriaDepositorAvailable SinceOct. 23, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-EED-2A-mTurquoise
Plasmid#225692PurposeLentiviral expression of rTetR(SE) fused to EED and mTurquoise-NLSDepositorInsertrTetR-EED (EED Human, Synthetic)
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLenti-rTetR(SE)-HP1a-2A-mTurquoise
Plasmid#225691PurposeLentiviral expression of rTetR(SE) fused to HP1a and mTurquoise-NLSDepositorInsertHP1a (CBX5 Human, Synthetic)
UseLentiviral and Synthetic BiologyTags3xFLAG and T2A-mTurquoiseExpressionMammalianAvailable SinceOct. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pET3a.H2B-K120C
Plasmid#224706PurposeExpresses Human H2B K120C mutant in bacterial cells for fluorescent labelling of histone octamersDepositorAvailable SinceOct. 18, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCAG-eSpCas9-2A-GFP-sgRNA-Lig4
Plasmid#220494PurposeTo generate LIG4 KO in human cells. Co-expresses eSpCas9(1.1), GFP and a guide RNA against LIG4 exon 3.DepositorAvailable SinceJuly 3, 2024AvailabilityAcademic Institutions and Nonprofits only -
pOTTC1642 - pAAV EF1a EGFP-KASH with mTACR1 gRNAs
Plasmid#195018PurposeAn adeno-associated viral vector expressing eGFP-KASH and two guides targeting mouse TACR1DepositorInsertsCCGTATAGGCGGCTGCCCAA
EGFP-KASH
TTCCGTGGTGGGCAACGTAG
UseAAVTagsKASH domain of Nesprin2PromoterEF1a, hU6, and mU6Available SinceJune 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pEMS1371
Plasmid#29172PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1373
Plasmid#29174PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pEMS1374
Plasmid#29175PurposeExpression of the reporter gene under the control of the MiniPromoter in this plasmid has not been testedDepositorAvailable SinceNov. 14, 2011AvailabilityAcademic Institutions and Nonprofits only -
pHR-TetOn-mCherry-OAZ1_FS-YFP
Plasmid#232356PurposeMammalian expression of dox-inducible polyamine sensor (polyamine levels = YFP/Cherry)DepositorInsertOAZ1 derived polyamine sensing module (OAZ1 Human)
UseLentiviralTagseYFP and mCherryExpressionMammalianPromoterTRE3GAvailable SinceMarch 7, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-hSyn-PinkyCaMP
Plasmid#232856PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under hSyn promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterhSynAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
PB-U6-sgRNA-BFP-Puro
Plasmid#229013PurposePerturb Seq sgRNA vector with PiggyBac backboneDepositorTypeEmpty backboneExpressionMammalianAvailable SinceJune 5, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CAG-PinkyCaMP
Plasmid#232860PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CAG promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterCAGAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-CaMKII-PinkyCaMP
Plasmid#232858PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under CaMKII promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromoterCaMKIIAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZac2.1-gfaABC1D-PinkyCaMP
Plasmid#232859PurposeAn AAV vector expressing the mScarlet based calcium indicator PinkyCaMP under gfaABC1D promoterDepositorInsertPinkyCaMP
UseAAVExpressionMammalianPromotergfaABC1DAvailable SinceFeb. 20, 2025AvailabilityAcademic Institutions and Nonprofits only