We narrowed to 23,293 results for: c-MYC
-
Plasmid#226272PurposePlasmid expressing the SEC22 allele from UWOPS87-2421, under control of its native promoterDepositorAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only
-
pRS315-SEC22-S288C
Plasmid#226270PurposePlasmid expressing the SEC22 allele from S288C, under control of its native promoterDepositorAvailable SinceOct. 30, 2024AvailabilityAcademic Institutions and Nonprofits only -
pML107-PMR1
Plasmid#226264PurposePlasmid expressing Cas9 and gRNA ACATGACCGTATCTAAACTT which targets the PMR1 geneDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
pRS316-SSD1-NCYC110
Plasmid#226279PurposePlasmid expressing the SSD1 allele from NCYC110, under control of its native promoterDepositorAvailable SinceOct. 28, 2024AvailabilityAcademic Institutions and Nonprofits only -
B52_puro_empty_gRNA
Plasmid#197557Purposesites for cloning two gRNA with puromycin cassetteDepositorTypeEmpty backboneUseEmpty grna backbone with puromycin resistance geneTagsExpressionMammalianMutationPromoterU6 for gRNA, CMV for puromycin resistance.Available SinceMarch 27, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEM_Δflv3.sm
Plasmid#185533Purposea pGEM-T easy vector containing the streptomycin/spectinomycin resistance cassette flanked by the two regions for the double homologous recombination on the flv3 locusDepositorInsertaadA gene flanked by flv3 upstream and downstream regions
UseSynthetic BiologyTagsExpressionMutationPromoterAvailable SinceOct. 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
Cas12aUltra_5XNLS
Plasmid#218775PurposeHis-TEV-Cas12aUltra-BPSV40_cMyc_NP_5NLSDepositorInsert5xNLS-BPSV40-NLP-cMyc-cMyc-BPSV40- AspCas12a
UseCRISPRTags6XHis (C terminal), HA, Nucleoplasmin, SV40, and …ExpressionBacterialMutationNucleotides mutations were made to encode for arg…PromoterAvailable SinceAug. 27, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
FLAG-PIWI(aa478-860)
Plasmid#21543DepositorInsertAgo2 (AGO2 Human)
UseTags3XFLAGExpressionMammalianMutationcontain only aa478-860PromoterAvailable SinceJuly 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
FLAG-PAZ(aa1-480)
Plasmid#21529DepositorInsertAgo2 (AGO2 Human)
UseTags3XFLAGExpressionMammalianMutationcontain only aa1-480PromoterAvailable SinceJuly 29, 2009AvailabilityAcademic Institutions and Nonprofits only