We narrowed to 4,841 results for: U6...
-
Plasmid#155053PurposeLentiviral plasmid for expressing U6 driven hybrid guide (hg)RNA for deletion of HPRT1 exon 3 using SpCas9 and LbCas12a nucleases (CHyMErA system)DepositorInsert(hg)RNA for deletion of HPRT1 exon 3
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromoterU6Available sinceAug. 12, 2020AvailabilityAcademic Institutions and Nonprofits only -
px330_Rosa_sgRNA
Plasmid#97007PurposeExpresses Cas9 and Rosa26 locus specific sgRNADepositorInsertRosa26 sgRNA
UseCRISPRTagsExpressionMammalianMutationPromoterU6Available sinceMarch 3, 2022AvailabilityAcademic Institutions and Nonprofits only -
pMSCV-miR30-Vector
Plasmid#171194PurposeRetroviral vector for U6 promoter driven expression empty miR30 based shRNA (to be used in conjunction with Phoenix packaging cells).DepositorInsertshRNA empty vector
UseRetroviralTagsExpressionMammalianMutationPromoterU6Available sinceMay 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pMJ117
Plasmid#85997PurposeOne-guide Perturb-seq vector backbone; modified human U6 promoter; constant region 3DepositorInsertsEGFP-NT2_cr3
puro-T2A-BFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermodified human U6Available sinceFeb. 2, 2017AvailabilityAcademic Institutions and Nonprofits only -
pMJ179
Plasmid#85996PurposeOne-guide Perturb-seq vector backbone; modified mouse U6 promoter; constant region 2DepositorInsertsEGFP-NT2_cr2
puro-T2A-BFP
UseCRISPR and LentiviralTagsExpressionMammalianMutationPromotermodified mouse U6Available sinceFeb. 22, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shGFP
Plasmid#110318PurposeControl (Target CAAGCTGACCCTGAAGTTCAT), silence GFP and express monomeric Kusabira-Orange2DepositorInsertGFP
UseLentiviral and RNAiTagsExpressionMammalianMutationPromoterRNA polymerase III promoter for human U6 snRNA fo…Available sinceAug. 13, 2018AvailabilityAcademic Institutions and Nonprofits only -
gRNA-10Xcapture-PuroR
Plasmid#211496PurposePlasmid for the expression of SAM-compatible gRNA for CRISPRa with capturer sequence for 10X Genomics sequencingDepositorInsertsU6-gRNA
Ef1a-PuroR
UseCRISPR, Lentiviral, and Synthetic BiologyTagsExpressionMammalianMutationPromoterEF1a and U6Available sinceDec. 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
gRNA3_NIPBL_Cas9-hGem-for_N-terminal_tagging
Plasmid#217662Purposeexpresses Cas9-hGem and guideRNA for N terminal tagging of NIPBLDepositorInsertsgRNA3 for N terminal tagging of NIPBL (NIPBL Human)
UseCRISPRTagsExpressionBacterial and MammalianMutationPromoterU6Available sinceJuly 29, 2024AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPRv2-sgRNAs-del-CDK5RAP2-SVA-BFP
Plasmid#202824PurposeLentiviral vector modified to express two sgRNAs that delete the intronic SVA within the CDK5RAP2 gene with EF-1apha for Cas9 and BFP expressionDepositorInserttwo sgRNAs (each with a U6 promoter) to delete SVA within CDK5RAP2 gene
UseLentiviralTagsExpressionMammalianMutationPromoterU6 - twoAvailable sinceJuly 6, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAAVS1-shRNA
Plasmid#82697PurposeFor targeting shRNA construct into human AAVS1 locus, using genome editing. Expresses shRNA of interest (cloning: EcoRI and AgeI) under U6 promoter, flanked by AAVS1 homology arms.DepositorTypeEmpty backboneUseRNAiTagsExpressionMutationPromoterhPGK, U6Available sinceNov. 11, 2016AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-1
Plasmid#181868PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianMutationPromoterU6Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
-
lenti-EGFR-L858R-T790M-dual-epegRNA
Plasmid#214100PurposeLentiviral vector expressing epegRNAs for the induction of EGFR L858R and T790M mutations, through tandem U6 expression of the two epegRNAs using independent U6 promoters.DepositorInsertEGFR L858R epegRNA/EGFR T790M epegRNA
UseLentiviralTagsExpressionMammalianMutationPromoterhU6Available sinceJune 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10715
Plasmid#183960PurposeU6-crOct4-CAG-hyperdCas12a-miniVPRDepositorInsertsHyperdCas12a
crRNA targeting Oct4
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAAV-shMcu-2
Plasmid#181867PurposeExpresses Mcu-targeted shRNA under control of the U6 promoter and hrGFP under control of the synthetic CAG promoterDepositorInsertmitochondrial calcium uniporter (Mcu Mouse)
UseAAV, Adenoviral, and Mouse TargetingTagshrGFPExpressionMammalianMutationPromoterU6Available sinceMarch 17, 2022AvailabilityAcademic Institutions and Nonprofits only -
pAcBac1-BacMam-4x-PyOtR
Plasmid#217364PurposeExpresses four copies pyrrolysyl tRNA variant "PyOtR" with U6 promoter; can be packaged in bacmidDepositorInsert4 copies of pyrrolysyl-tRNA mutant PyOtR
UseBaculoviralTagsExpressionInsect and MammalianMutationPromoterU6Available sinceMay 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pSLQ10713
Plasmid#183958PurposeU6-crSox2-CAG-hyperdCas12a-miniVPRDepositorInsertsHyperdCas12a
crRNA targeting Sox2
UseCRISPRTagsHAExpressionMammalianMutationD832A, D156R, E292R, D235R, D350RPromoterCAG and U6Available sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
eSpCas9-plus
Plasmid#126767PurposeExpression plasmid for human codon-optimized increased fidelity eSpCas9-plus (w/o U6-sgRNA). Cleaves both 20nt and 5'-extended 21nt spacer containing sgRNAs with close to the same fidelity as eSpCas9.DepositorInserteSpCas9-plus
UseCRISPRTags3xFLAG and NLSExpressionMammalianMutationK848A, R1060A; amino acids 1005-1013 replaced wit…PromoterCBhAvailable sinceMarch 6, 2020AvailabilityAcademic Institutions and Nonprofits only -
crTet in pSLQ8453
Plasmid#183965PurposeU6-crTet-EF1a-Puro-T2A-BFP-WPREDepositorInsertcrTet
UseLentiviralTagsEF1a-Puro-T2A-BFPExpressionMammalianMutationPromoterU6Available sinceJune 1, 2022AvailabilityAcademic Institutions and Nonprofits only -
pEF004-sgRNA-shuffle-in
Plasmid#104440PurposeProvide and shuffle a cassette of AtU6:sgRNA-transRNA into SM-destination vectors (pRW006 and pRW004) with golden gate cloning strategy. Work together with pEF005DepositorInsertsgRNA-transRNA transcription by U6 promoter
UseCRISPRTagsExpressionBacterial and PlantMutationPromoterU6 promoterAvailable sinceDec. 27, 2017AvailabilityAcademic Institutions and Nonprofits only