We narrowed to 29 results for: U6...

...slightly lower expression than U6. May have better expression in neuronal cells. U6 small RNA expression shRNA...shRNA From the human U6 small nuclear promoter Constitutive  Murine U6 is also used, but may be less efficient...

...the years on their own or through Addgene!) pX330-U6-Chimeric_BB-CBh-hSpCas9 - The S. pyogenes Cas9 (SpCas9...cloned to create a chimeric guide RNA. Find pX330-U6-Chimeric_BB-CBh-hSpCas9. pSpCas9(BB)-2A-Puro (PX459...chimeric RNA element with customizable sgRNA from the U6 promoter and puromycin resistance from the EF-1a ...

...target sequence downstream of the 7SK, human U6, mouse U6, or human H1 promoters. If you express fewer...modification of pX330, contains humanized wtCas9 and two U6 promoters. To use this plasmid, you simply order ...and up to three gRNAs. Entry vectors containing the U6 promoter and the gRNA scaffold are provided with ... cloning. gRNAs are expressed from two Drosophila U6 promoters. Cas9 must be supplied on a separate plasmid...

... first site accepts the sgRNA target sequence for U6 promoter expression and the second site accepts the...containing a direct fusion of the desired gRNA to the U6 promoter, and a second plasmid containing the homology...

... upstream of the Cbh promoter, this plasmid has a U6 promoter followed by BbsI restriction sites into ...

...are described here. #60224 - AAV:ITR-U6-sgRNA(Kras)-U6-sgRNA(p53)-U6-sgRNA(Lkb1)-pEFS-Rluc-2A-Cre-shortPA-KrasG12D_HDRdonor-ITR...PX601; CMV-driven SaCas9; U6-driven sgRNA 61593 : PX602; TBG-driven SaCas9; U6-driven sgRNA 61592 : PX600...promoter-driven SpCas9; for neuronal expression 60958 : PX552; U6 promoter-driven; for sgRNA cloning; has GFP-KASH ...binding globulin (TBG, PX602 [#61593] ) promoter, and a U6-driven single guide RNA. The vector can be digested...acceptor: The PX552 plasmid (#60958) contains pAAV-U6::sgRNA(SapI)_hSyn-GFP-KASH-bGH (SpGuide acceptor)... directed repair donor template. #60225 - AAV:ITR-U6-sgRNA(LacZ)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This ...is used as a control for AAV-KPL. #60226 - AAV:ITR-U6-sgRNA(backbone)-pEFS-Rluc-2A-Cre-WPRE-hGHpA-ITR This...

...why pC016 - LwCas13a guide expression backbone with U6 promoter has already earned a blue flame. RNA Editing...

...Drosophila U6:3 pegRNA BbsI No Vermilion Norbert Perrimon 149546 pCFD5-NS Drosophila Drosophila U6:3 pegRNA...Vermilion Norbert Perrimon 164423 pHSG1C3 Mammalian U6 pegRNA + nicking sgRNA BbsI for sgRNAs; BbsI + PstI...Mammalian hU6 epegRNA BsaI No mRFP1 David Liu 176901 U6-pe RNA-H1-nick sgRNA-mCherry Mammalian...

...Yildiz 159787 pGL3-U6-pegRNA_KCNA1-EGFP KCNA1 U6 Episodic ataxia Xiaolong Wang 159788 pGL3-U6-sgRNA_KCNA1-mcherry...190900 pAAV2ss-U6-sgHTT1-7sk-sgCas9 HTT U6, 7sk Huntington's Nicole Deglon 190901 pAAVss-U6-sgHTT51-7sk-...7sk-Cas9 HTT U6, 7sk Huntington's Nicole Deglon 190902 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1 HTT GFP U6, EFS Huntington's...Deglon 190903 pAAV2ss-EFS-GFP-synPolyA-U6-sgHTT1-U6-sgCas9 HTT GFP U6, EFS Huntington's Nicole Deglon 191487...(BRDN0001145663) TBK1 U6 ALS David Root 76362 TBK1 gRNA (BRDN0001148392) TBK1 U6 ALS David Root 76363 ... (BRDN0001148607) TBK1 U6 ALS David Root 76470 GAK gRNA (BRDN0001146687) GAK U6 Parkinson's David Root...BRDN0001146263) GAK U6 Parkinson's David Root 76472 GAK gRNA (BRDN0001148048) GAK U6 Parkinson's David ...

...Plasmid Generation Description PI 8453 pLKO.1 puro 3rd U6-driven shRNA empty plasmid with puromycin selection...Bob Weinberg 10878 pLKO.1 – TRC cloning plasmid 3rd U6-driven shRNA empty plasmid. Includes a stuffer for...for easy cloning. David Root 14748 pLKO.3G 3rd U6-driven shRNA empty plasmid with EGFP marker. See plasmid...Trono 11795 pLL3.7 3rd Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included ...epigenetic silencing. Expresses shRNA under mouse U6 promoter. CMV-EGFP reporter cassette is included ...

...strategy, the need for lengthy promoters, such as U6 or EF1α promoters, has limited the number of gRNAs...

...target sequence into a backbone that uses the human U6 promoter to drive expression, is it necessary to ...to the start of my target sequence? A3: The human U6 promoter prefers a 'G' at the transcription start...

...reporters via an H2B fusion shuttle plasmid for shuttling U6-guide cassettes to make dual guide expressing plasmids...shuttle plasmids to insert a second guide within a U6-guide cassette. This process is compatible with all...

...Libraries express hybrid Cas9-Cas12a gRNAs under a single U6 promoter. The paralog and dual-targeting hybrid gRNA...

...Cas9 expression can be constitutive or inducible. U6 promoter is typically used for gRNA. May contain ...

...expresses S. pyogenes Cas9 from the PGK promoter) and U6 promoter-driven guide RNA constructs, pAdSh.U6.gRNAS1...

...uniquely transcribed by RNA Polymerase III (5S, tRNA and U6) and measuring Corn fluorescence by flow cytometry...

...GGGAAACGCCTGGTATCTTT Human U6 promoter Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward M13... binding domain Forward LKO.1 5' (U6) GACTATCATATGCTTACCGT Human U6 promoter Forward LNCX AGCTCGTTTAGTGAACCGTCAGATC...terminator Reverse hU6-F GGGAAACGCCTGGTATCTTT Human U6 promoter Forward hUBCpro-F TGAAGCTCCGGTTTTGAACT Human...promoter Forward mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter Forward Myc GCATCAATGCAGAAGCTGATCTCA Myc...Tn7 Reverse? TRC-F CAAGGCTGTTAGAGAGATAATTGGA Human U6 promoter Forward Ubx-F AACTCGTACTTTGAACAGGC Drosophila...

...transcribe small RNAs. The most common promoters are U6, H1, and 7SK. These are strong promoters with no ...

...cDNA expression, sgRNA (U6) expression, shRNA/shRNA-miR30 constitutive (H1, U6, 7SK) or inducible shRNA-miR30...of the available sgRNA-cargo constructs utilize a U6 promoter and contain the RNA cargo cassette inserted...