...LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LucNrev CCTTATGCAGTTGCTCTCC...LKO.1 5' GACTATCATATGCTTACCGT (Weinberg Lab) Human U6 promoter, forward primer LNCX AGCTCGTTTAGTGAACCGTCAGATC... forward primer mU6-F CAGCACAAAAGGAAACTCACC Mouse U6 promoter, forward primer Myc GCATCAATGCAGAAGCTGATCTCA... TRC-F CAAGGCTGTTAGAGAGATAATTGGA (Root lab) Human U6 promoter, forward primer Ubx-F AACTCGTACTTTGAACAGGC...

...Tetracycline response element promoter U6 Constitutive Human U6 nuclear promoter for small RNA expression...

...included within a transfer plasmid: for example, the U6 promoter is included in the pSico plasmid to drive...shRNA‐expressing lentiviral plasmids, such as pLKO.1, use a U6 or H1 promoter in order to drive RNA pol III-directed...

...constitutive (CMV, EF1alpha, CBh) or inducible (Tet-ON); U6 promoter is typically used for gRNA May contain reporter...