We narrowed to 13,324 results for: HAE

#169510

Tier-1 vector encoding PhCMV-driven green fluorescent protein turbo GFP (PhCMV-tGFP-pA).

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

June 16, 2022

Academic Institutions and Nonprofits only

#245864

Archael (13cm_4210_3138-4177(-) _Thor) 16S rRNA expression

Roland Hatzenpichler

Van Beek et al Microbiol Resour Announc. 2025 Dec 11;14

Oct. 30, 2025

Academic Institutions and Nonprofits only

#245863

Archael (Methanomassiliicoccus luminyensis B10) 16S rRNA expression

Roland Hatzenpichler

Van Beek et al Microbiol Resour Announc. 2025 Dec 11;14

Oct. 30, 2025

Academic Institutions and Nonprofits only

#245856

Archael (Methanosuratincola verstraetei LCB70) 16S rRNA expression

Roland Hatzenpichler

Van Beek et al Microbiol Resour Announc. 2025 Dec 11;14

Oct. 30, 2025

Academic Institutions and Nonprofits only

#245855

Archael (Methanoglobus hypatiae LCB24) 16S rRNA expression

Roland Hatzenpichler

Van Beek et al Microbiol Resour Announc. 2025 Dec 11;14

Oct. 30, 2025

Academic Institutions and Nonprofits only

#229519

Expresses Phaeoceros carolinianus Rubisco large and small subunit (C terminus hexahistidine)

Laura Gunn

Oh et al Mol Plant. 2024 Dec 2;17(12):1833-1849.

June 20, 2025

Academic Institutions and Nonprofits only

#169571

Tier-1 vector encoding PhCMV-driven KRAB transsilencer domain (PhCMV-KRAB-pA).

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

Sept. 19, 2022

Academic Institutions and Nonprofits only

#169639

Tier-3 vector for stable stable integration of up to three cassettes via sleeping beauty transposase including a PuroR resistance gene (5'ITR-A1-pA::A2-pA::PRPBSA-PuroR-pA-3'ITR)

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 13, 2022

Academic Institutions and Nonprofits only

#169630

pX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 13, 2022

Academic Institutions and Nonprofits only

#169619

Tier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).

Martin Fussenegger

Haellman et al Metab Eng. 2021 Jul;66:41-50. doi: 10.10

July 12, 2022

Academic Institutions and Nonprofits only