We narrowed to 14,309 results for: CAN
-
Plasmid#112953PurposeIn vivo visualization of Transferrin receptors (can be used for colocalization studies)DepositorInsertpTfR
TagsmTurquoise2ExpressionMammalianPromoterCMVAvailable SinceSept. 25, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLSU1/o35S[]:MCS:NosT
Plasmid#212163PurposeThis binary vector has an empty backbone where you can insert a gene into a cassette with a strong promoter (original 35sCAMV)DepositorTypeEmpty backboneExpressionPlantAvailable SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
CytERM-mKOkappa
Plasmid#98832PurposeIn vivo visualization of the ER (can be used for colocalization studies and the OSER assay)DepositorInsertCytERM
TagsmKOkappaExpressionMammalianPromoterCMVAvailable SinceAug. 17, 2017AvailabilityAcademic Institutions and Nonprofits only -
CytERM_3xmTurquoise2
Plasmid#112958PurposeIn vivo visualization of the ER (can be used for colocalization studies and the OSER assay)DepositorInsertCytERM
Tags3x mTurquoise2ExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLSU1/t35S[]:MCS:NosT
Plasmid#212164PurposeThis binary vector has an empty backbone where you can insert a gene into a cassette with a strong promoter (truncated35sCAMV)DepositorTypeEmpty backboneExpressionPlantAvailable SinceMarch 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
AdenoBuilder toolkit
Plasmid Kit#1000000176PurposePlasmids containing modular inserts that span the human adenovirus serotype 5 (HAdV5) genome that can be assembled in a one-tube reaction.DepositorApplicationCloning and Synthetic Biology, Gene Expression and LabelingVector TypeAdenoviral, Mammalian ExpressionCloning TypeGibsonAvailable SinceDec. 1, 2021AvailabilityAcademic Institutions and Nonprofits only -
pTfR-mScarlet-I
Plasmid#112954PurposeIn vivo visualization of Transferrin receptors (can be used for colocalization studies)DepositorInsertpTfR
TagsmScarlet-IExpressionMammalianPromoterCMVAvailable SinceAug. 28, 2018AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-h53BP1 (siRNA resistant)
Plasmid#110301PurposeMammalian expression of a EGFP-tagged full length human 53BP1 (resistant to siRNA targeting AGAACGAGGAGACGGTAATAGTGGG)DepositorInsertp53-binding protein 1 (TP53BP1 Human)
TagsEGFPExpressionMammalianMutationGAACGAGGA to GAGCGGGGCAvailable SinceMay 23, 2018AvailabilityAcademic Institutions and Nonprofits only -
pFastBac Dual α1B/β2B Tubulin
Plasmid#170553PurposeEncodes codon-optimized human α1B and β2B tubulin for expression in and purification from insect cells.DepositorTagsAP linker, GS linker (GGSGG), His10 tag, L21 enha…ExpressionInsectAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only -
pFastBac Dual α1B/β3 Tubulin
Plasmid#170552PurposeEncodes codon-optimized human α1B and β3 tubulin for expression in and purification from insect cells.DepositorTagsAP linker, GS linker (GGSGG), His10 tag, L21 enha…ExpressionInsectAvailable SinceJune 15, 2021AvailabilityAcademic Institutions and Nonprofits only