We narrowed to 10,667 results for: plasmids 101
-
Plasmid#228154PurposePlasmid contains the secretion signal peptide sequence of the human LRP8 gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_Q14114_LRP8_HUMAN:0-32
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_B5
Plasmid#228155PurposePlasmid contains the secretion signal peptide sequence of the human CCL7 gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_P80098_CCL7_HUMAN:0-23
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_B6
Plasmid#228156PurposePlasmid contains the secretion signal peptide sequence of the human CREG1 gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_O75629_CREG1_HUMAN:0-31
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_C1
Plasmid#228157PurposePlasmid contains the secretion signal peptide sequence of the yeast MEL6 gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_P41947_MEL6_YEASX:0-18
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_C2
Plasmid#228158PurposePlasmid contains the secretion signal peptide sequence of the yeast (S. mikatae) MEL gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_Q11129_MEL_SACMI:0-18
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_C4
Plasmid#228160PurposePlasmid contains the secretion signal peptide sequence of the human AFAM gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_P43652_AFAM_HUMAN:0-21
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_C5
Plasmid#228161PurposePlasmid contains the secretion signal peptide sequence of the human STRCL gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_A6NGW2_STRCL_HUMAN:0-25
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_C6
Plasmid#228162PurposePlasmid contains the secretion signal peptide sequence of the human NELL1 gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_Q92832_NELL1_HUMAN:0-21
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_A1
Plasmid#228145PurposePlasmid contains the secretion signal peptide sequence of the yeast MEL1 gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_P04824_MEL1_YEASX:0-18
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_A2
Plasmid#228146PurposePlasmid contains the secretion signal peptide sequence of the yeast (S. uvarum) SPR1 gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_Q876J2_SPR1_SACU7:0-20
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_A3
Plasmid#228147PurposePlasmid contains the secretion signal peptide sequence of the human ECM33 gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_P38248_ECM33_YEAST:0-19
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_A4
Plasmid#228148PurposePlasmid contains the secretion signal peptide sequence of the human CHADL gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_Q6NUI6_CHADL_HUMAN:0-30
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
SP_A5
Plasmid#228149PurposePlasmid contains the secretion signal peptide sequence of the human GDF8 gene for use in Combinatorial Golden Gate Assembly (BsaI restriction sites).DepositorInsertsp_O14793_GDF8_HUMAN:0-18
UseSynthetic BiologyAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL4.11_Nued2_E1_dAP1-2
Plasmid#203837PurposeLuciferase reporter plasmid for Igf1 enhancer 1 with both AP-1 sites knocked outDepositorInsertdAP1-2
ExpressionMammalianMutationKO of both AP1 sitesAvailable SinceOct. 17, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.11_Nued2_E1_dAP1
Plasmid#203835PurposeLuciferase reporter plasmid for Igf1 enhancer 1 containing only the downstream AP1 siteDepositorInsertdAP1
ExpressionMammalianMutationKO of AP1 upstreamAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGL4.11_Nued2_E1_dAP2
Plasmid#203836PurposeLuciferase reporter plasmid for Igf1 enhancer 1 containing only the upstream AP1 siteDepositorInsertdAP1
ExpressionMammalianMutationKO of AP1 downstreamAvailable SinceAug. 7, 2023AvailabilityAcademic Institutions and Nonprofits only -
pgTS40
Plasmid#169630PurposepX330 derived vector for PCAG driven expression of SpCas9 and PU6 driven expression of guide RNA OGTS40 (5' GGGGCCACTAGGGACAGGAT 3') targeting position 55115755 of chromosome 19.DepositorInsertU6-driven gRNA expression and PCAG-driven SpCas9 expression
ExpressionMammalianPromoterU6 / PCAGAvailable SinceJuly 13, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1041
Plasmid#169619PurposeTier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::A2-pA::PmPGK1-IgkSS-Nluc-p2A-mTagBFP2-pA).DepositorInsertPPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPPGKAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pVH228-Tier1-OVanO2-PCMVmin2-SEAP
Plasmid#169564PurposeTier-1 vector encoding PVanO2-driven SEAP expression (OVanO2-PCMVmin-2-SEAP-pA).DepositorInsertvanillic acid-controlled SEAP production
ExpressionMammalianPromoterVanO2-PCMVminAvailable SinceJuly 12, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTS1040
Plasmid#169618PurposeTier-2 vector encoding PPGK-driven secreted Nluc coupled to fluorescent reporter mTagBFP2 (A1-pA::PPGK-IgkSS-Nluc-p2A-mTagBFP2-pA::A3-pA).DepositorInsertPPGK-driven expression of secreted Nluc and mTagBFP2
ExpressionMammalianPromoterPPGKAvailable SinceJune 28, 2022AvailabilityAcademic Institutions and Nonprofits only