We narrowed to 8,851 results for: epor
-
Plasmid#29107PurposeExpression of the eGFP reporter gene was not detected in the brain and eye.DepositorAvailable SinceNov. 4, 2011AvailabilityAcademic Institutions and Nonprofits only
-
SP-cTAT-zsGreen-IRES-H2B-tdTomato
Plasmid#254722PurposeExpresses secreted, cell-penetrating form of zsGreen for niche labeling and expresses H2B-tdTomato as nuclear reporter.DepositorInsertSP-cTAT-zsGreen-IRES-H2B-tdTomato
ExpressionBacterial and MammalianPromoterPGKAvailable SinceApril 7, 2026AvailabilityAcademic Institutions and Nonprofits only -
huCofilin K22Q SSR-mRFP
Plasmid#252617PurposeExpresses shRNA resistant human cofilin with K22Q mutation that reduces nuclear uptake and serves as a cofilactin rod reporterDepositorInsertcofilin 1 (CFL1 Human)
TagsmRFPExpressionMammalianMutationK22Q; silent mutations at nt 67 to 75 in which TC…PromoterCMVAvailable SinceMarch 5, 2026AvailabilityIndustry, Academic Institutions, and Nonprofits -
LentiX_(loxPconDIAL-YB_TATA)-mCherry-HRasG12V-BGH_pKG3906
Plasmid#246345PurposeloxPcon DIAL Reporter Lentivirus expressing mCherry-HRasG12V in the presence of ZFaDepositorAvailable SinceNov. 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
MB 101A ttrSR(m13)-sfGFP_mCherry
Plasmid#232474PurposeOptimized tetrathionate sensor with fluorescent reporter (GFP), constitutive mCherryDepositorInsertsttrS
ttrR
PttrB185-269
sfGFP
AxeTxe
mCherry
ExpressionBacterialPromoterConstitutive (TTGATAGCTAGCTCAGTCCTAGGTATTGTGCTAGC…Available SinceSept. 17, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror GFP[ENE(WT)-mascRNA](pAVA2965)
Plasmid#239351PurposeExpresses TEV protease and tandemly-repeated GFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mStayGold-WPRE (JDW 1384)
Plasmid#242550PurposeGateway middle entry clone containing H2B-mStayGold with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmStayGold (monomeric StayGold)
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-H2B-mBaoJin-WPRE (JDW 1383)
Plasmid#242549PurposeGateway middle entry clone containing H2B-mBaoJin with WPRE at the 3' end; Nuclear green fluorescent reporterDepositorInsertmBaoJin
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
pME-mCerulean3-TUBB1A (JDW 1508)
Plasmid#242555PurposeGateway middle entry clone containing mCerulean3-TUBB1A; Cyan fluorescent reporter for visualizing tubulin in cellsDepositorInsertmCerulean3-TUBB1A
UseGateway subcloningAvailable SinceAug. 25, 2025AvailabilityAcademic Institutions and Nonprofits only -
Mirror RFP[ENE(WT)-mascRNA](pAVA2987)
Plasmid#239348PurposeExpresses TEV protease and tandemly-repeated RFP fluorescent proteins to amplify the fluorescence signal produced by a single transcription unit of wild-type MALAT1 ENE-mascRNA reporter.DepositorInsertMALAT1 ENE(WT)-mascRNA
ExpressionMammalianAvailable SinceAug. 15, 2025AvailabilityAcademic Institutions and Nonprofits only