We narrowed to 2,739 results for: EXO
-
Plasmid#147218PurposeMammalian Expression of HsDCP1a-Y36ADepositorInsertHsDCP1a-Y36A (DCP1A Human)
ExpressionMammalianMutationtwo silent mutations T237C and G1716T compared to…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del136-152-siRNAres_K
Plasmid#146750PurposeMammalian Expression of HsSmg6-del136-152-siRNAresDepositorInsertHsSmg6-del136-152-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pETM41P-HsUPF3b-iso2_145-470_K
Plasmid#146754PurposeBacterial Expression of HsUPF3biso2_145-470DepositorInsertHsUPF3biso2_145-470 (UPF3B Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pGEX-6P-1-HsUPF3b-iso2_145-470_K
Plasmid#146759PurposeBacterial Expression of HsUPF3biso2_145-470DepositorInsertHsUPF3biso2_145-470 (UPF3B Human)
ExpressionBacterialAvailable SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del42-58-del136-152-siRNAres_K
Plasmid#146748PurposeMammalian Expression of HsSmg6-del42-58-del136-152-siRNAresDepositorInsertHsSmg6-del42-58-del136-152-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCIneo-V5-SBP-HsSmg6-del817-1238-siRNAres_I
Plasmid#146555PurposeMammalian Expression of HsSmg6-del817-1238-siRNAresDepositorInsertHsSmg6-del817-1238-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pEYFP-N1-HsSmg6-del817-1238-siRNAres_I
Plasmid#146564PurposeMammalian Expression of HsSmg6-del817-1238-siRNAresDepositorInsertHsSmg6-del817-1238-siRNAres (SMG6 Human)
ExpressionMammalianMutationtwo silent mutations T594C, A699G and two non sil…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pLNHA-C1-HsUPF3biso2_I
Plasmid#146568PurposeMammalian Expression of HsUPF3Biso2DepositorInsertHsUPF3Biso2 (UPF3B Human)
ExpressionMammalianMutationone silent mutation T510C compared to the sequenc…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 10-12WT
Plasmid#194167PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 10-12 . Expresses the tau circular RNA 12-->10 WT with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 WT
Tags3X FlagExpressionMammalianAvailable SinceJan. 13, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_Tau Authentic Alu 7-12WT
Plasmid#194170PurposeInsert contains intronic Tau authentic Alu and repeat elements. The introns are flanked by the Wild Type tau cDNA exons 7,9-12 . Expresses the tau circular RNA 12-->7 WT with 3X flag tag in exon 7.DepositorInsertmicrotubule-associated protein tau 7-12 WT
Tags3x FlagExpressionMammalianAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pcDNA3.1_ZKSCAN1_Tau10-12V337M
Plasmid#194165PurposeInsert contains intronic ZKSCAN1 Alu repeat elements flanked by tau cDNA exons 10-12 with FTLD-Tau V337M mutation. Expresses the tau circRNA 12-->10 V337M with 3X flag tag in exon 10.DepositorInsertMicrotubule-associated protein tau 10-12 V337M
ExpressionMammalianMutationChanged Valine 337 to MethinonineAvailable SinceJan. 12, 2023AvailabilityAcademic Institutions and Nonprofits only -
pAP14
Plasmid#186262PurposewgaA (a.k.a expA1) and wgaB (a.k.a expA23), bicistronic, under light light responsive PEL222 promoter and EL222 under constitutively active LacIq promoterDepositorInsertsExpressionBacterialPromoterLacIq (CGAATGGTGCAAAACCTTTCGCGGTATGGCATGATAGCGCCC…Available SinceAug. 15, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-62-SFFV-T2A-PuroR-polyA-R11b
Plasmid#179893PurposeDonor with homologous arms for Rab11b to knock in SFFV-T2A-Puromycin resistance-PolyA cassette (for knock out)DepositorInsertRAB11B, member RAS oncogene family (RAB11B Human)
UseCRISPR; Donor for homologous based knock inExpressionBacterial and MammalianPromoterSFFVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pJET-64-SFFV-T2A-BlaR-polyA-R11b
Plasmid#179895PurposeDonor with homologous arms for Rab11b to knock in SFFV-T2A-Blasticidin resistance-PolyA cassette (for knock out)DepositorInsertRAB11B, member RAS oncogene family (RAB11B Human)
UseCRISPR; Donor for homologous based knock inExpressionBacterial and MammalianPromoterSFFVAvailable SinceMay 31, 2022AvailabilityAcademic Institutions and Nonprofits only -
pcDNA-Prom1 Del EC2
Plasmid#184025PurposeMammalian Flag tagged expression clone for the mouse Prom1 splicing variant SV8 (GenBank accession BC028286). Deletion of exon 19a (amino acids 696-701), and deletion of amino acids 273-287.DepositorInsertProm1 SV8(-Ex19a) Del EC2 (Prom1 Mouse)
TagsFlagExpressionMammalianMutationDeletion of exon 19a (amino acids 696-701), and d…Available SinceMay 23, 2022AvailabilityAcademic Institutions and Nonprofits only -
GFP-Tac-STC
Plasmid#162490PurposeExpresses partial length Tac (stem region, TMD and cytosolic tail) with GFP tag in mammalian cellsDepositorInsertpartial length Tac (stem region, TMD and cytosolic tail) (IL2RA Human)
TagsGFPExpressionMammalianMutationTac is in partial length with its stem region, TM…Available SinceJan. 29, 2021AvailabilityAcademic Institutions and Nonprofits only -
pCMV-GABARα6N-HA
Plasmid#128111PurposeExpress HA tagged GABARα6 N terminal domainDepositorAvailable SinceSept. 19, 2019AvailabilityAcademic Institutions and Nonprofits only -
PL-5LTR-RGR(DMD#1)-AmCyan-A
Plasmid#138482PurposeExpresses sgRNA targeting human DMD (Dystrophin) for packaging into NanoMEDIC particle.DepositorInsertRibozyme-flanked gRNA and AmCyan
UseCRISPRExpressionMammalianAvailable SinceMarch 23, 2020AvailabilityAcademic Institutions and Nonprofits only -
Str-KDEL_CD63-SBP-mCherry
Plasmid#222326PurposeSynchronize the trafficking of CD63 from the ER.DepositorInsertStreptavidin-KDEL and CD63 fused to SBP-mCherry (CD63 Human)
ExpressionMammalianPromoterCMVAvailable SinceFeb. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pT7-EGFP-C1-HsUPF3biso2_I
Plasmid#146574PurposeMammalian Expression of HsUPF3biso2DepositorInsertHsUPF3biso2 (UPF3B Human)
ExpressionMammalianMutationone silent mutation T510C compared to the sequenc…Available SinceMarch 16, 2023AvailabilityAcademic Institutions and Nonprofits only