We narrowed to 12,273 results for: shRNA
-
Plasmid#193703PurposeConstitutive lentiviral expression of SLC2A1 shRNADepositorInsertSLC2A1 (SLC2A1 Human)
UseLentiviralAvailable SinceDec. 19, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLV-shNC-mCherry
Plasmid#222962PurposeNegative control for lentiviral shRNADepositorInsertNegative control
UseLentiviralAvailable SinceOct. 17, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1REST_sh_seq2_WPRE
Plasmid#127574PurposeshRNA to knock down RE1-silencing transcription factor (REST)DepositorAvailable SinceJuly 18, 2019AvailabilityAcademic Institutions and Nonprofits only -
pU6-(BbsI)_CBh-Cas9-T2A-mCherry-H1-(BamHI)
Plasmid#64217PurposeExpression vector for sgRNAs cloned into the BbsI sites, shRNAs into BamHI & AflII and for Expression of Cas9 linked to mCherry via T2ADepositorInsertsCas9
hU6 promoter; BbsI sites for sgRNA
H1 promoter; BamHI site for shRNA
UseCRISPRTags3xFLAG, NLS, and T2A-mCherryExpressionMammalianPromoterCBh, H1, and U6Available SinceSept. 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
MSCV p2GM AMPK alpha2hp1 alpha1hp1
Plasmid#89492PurposeshRNA against AMPK alpha2 and alpha1 in mouse/human to knock down protein expressionDepositorInsert2 hairpins against mouse/human AMPKalpha1 and alpha2
UseRetroviralExpressionMammalianPromoterU6 (The GFP-Puro is from a PGK promoter; the shRN…Available SinceMay 19, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-tetON-shOGDH 2497
Plasmid#110942PurposeTet-inducible shRNA targeting OGDHDepositorAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-tetON-shOGDH 1714
Plasmid#110941PurposeTet-inducible shRNA targeting OGDHDepositorAvailable SinceNov. 2, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO-puro-tetON-shOGDH 2956
Plasmid#110943PurposeTet-inducible shRNA targeting OGDHDepositorAvailable SinceOct. 31, 2018AvailabilityAcademic Institutions and Nonprofits only -
61426-hU6-shmFmr1-EF1a-mCherry
Plasmid#157859PurposeExpresses a shRNA targeting mouse Fmr1 geneDepositorAvailable SinceJan. 4, 2021AvailabilityAcademic Institutions and Nonprofits only -
sh-SRF
Plasmid#100797Purposeexpression of shRNA targeting SRFDepositorInsertrat SRF
UseRNAiPromoterH1Available SinceSept. 11, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO-sh-Nix
Plasmid#100770PurposeLentiviral expression of shRNA targeting NixDepositorInsertLenti-sh-Nix
UseLentiviralExpressionMammalianPromoterhU6Available SinceSept. 8, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shB3GNT5.1
Plasmid#110325PurposeTRCN0000034809 (Target GCCTATGTAATCTCCGGTGAT), silence human B3GNT5 gene and express monomeric Kusabira-Orange2DepositorInsertB3GNT5 (B3GNT5 Human)
UseLentiviral and RNAiExpressionMammalianPromoterRNA polymerase III promoter for human U6 snRNA fo…Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
pLKO.5 shETV4-B
Plasmid#74976PurposeshETV4 shRNADepositorAvailable SinceMay 10, 2017AvailabilityAcademic Institutions and Nonprofits only -
pLV-shEsr2
Plasmid#120722PurposeLentiviral vector that expresses GFP and an shRNA targeting Esr2 (in pLL3.7).DepositorAvailable SinceJuly 16, 2020AvailabilityAcademic Institutions and Nonprofits only -
pLKO_HOXB13_#2
Plasmid#70094PurposeExpression of shRNA to human HOXB13, puromycin selectionDepositorAvailable SinceNov. 6, 2015AvailabilityAcademic Institutions and Nonprofits only -
pEGFP-Sec22b-P33-shR
Plasmid#208359PurposeMammalian expression of fluorescent N-terminally tagged shRNA resistant Sec22b-P33 mutantDepositorInsertSec22b (Sec22b Rat)
TagsEGFPExpressionMammalianMutationfour silent mutations (shRNA resistance), 33 aa p…PromoterCMVAvailable SinceApril 16, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-Tet-Puro-shMMERVK10c_1 (inducible)
Plasmid#189955PurposeshRNA mediated knockdownDepositorInsertERV_MMERVK10c
UseLentiviralAvailable SinceSept. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
MSCV-shCasp2-IRES-GFP
Plasmid#52061Purposestable knockdown of Caspase-2 in mammalian cellsDepositorAvailable SinceMarch 13, 2014AvailabilityAcademic Institutions and Nonprofits only -
3788 pmko-neo A9-1
Plasmid#8878DepositorAvailable SinceJan. 6, 2006AvailabilityAcademic Institutions and Nonprofits only -
pSUPER-retro-puro-Smad2
Plasmid#89827PurposeKnockdown human Smad2 expression in human mammalian cellsDepositorInsertSMAD2 shRNA (SMAD2 Human)
UseRetroviralAvailable SinceMay 9, 2017AvailabilityAcademic Institutions and Nonprofits only