We narrowed to 55,886 results for: plasmid
-
Plasmid#65886PurposeLuciferase assay vector, assessing regulation of NDUFA6 3' UTRDepositorInsertNDUFA6 (NDUFA6 Human)
ExpressionMammalianAvailable SinceJuly 2, 2015AvailabilityAcademic Institutions and Nonprofits only -
pBS ZfHoxc6a
Plasmid#27541DepositorInsertHoxc6a (hoxc6a Zebrafish)
UseCloning vectorAvailable SinceFeb. 24, 2011AvailabilityAcademic Institutions and Nonprofits only -
pCODE-3
Plasmid#247475PurposePlasmid for inducible expression of six tRNA encoding genes (argX, glyT, leuW, proL, argU, and ileX) in Escherichia coli, based on pSEVA121 backboneDepositorInsertargX, glyT, leuW, proL, argU, and ileX
ExpressionBacterialMutationRearrangement of tRNA operon, tRNA flanking regio…PromoterpTetAvailable SinceNov. 4, 2025AvailabilityAcademic Institutions and Nonprofits only -
pAAV-G1B3-GFP-WPRE-miR124T-SYNpolyA
Plasmid#245081PurposeFluorescent reporter gene, with miRNA-124 target sequence to repress transgene expression in neuronsDepositorInsertEGFP
UseAAVExpressionMammalianPromoterHuman G1B3 promoterAvailable SinceOct. 8, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGloSensor -30F DEVD Caspase Vector
Plasmid#236880PurposeExpress -30F DEVD for Caspase 3/7 assayDepositorHas ServiceDNAInsert-30F DEVD
UseLuciferaseMutationNonePromoterCMVAvailable SinceJuly 14, 2025AvailabilityIndustry, Academic Institutions, and Nonprofits -
pAAV-Tre3G-Flag-Rat Arc-Arc 3' UTR
Plasmid#233054PurposeTo express Flag-tagged Rat Arc from a TRE3g promoter. The Arc gene contains the Rat Arc 3'UTR containing NO intronsDepositorInsertRat Arc
UseAAVTagsFlagAvailable SinceJuly 14, 2025AvailabilityAcademic Institutions and Nonprofits only -
psiCHECK-2 GATD1 Alu_Mut2
Plasmid#205471PurposeLuciferase reporter for Alu Domain ActivityDepositorInsertMutant 2 GATD1 Alu Domain
UseLuciferase and RNAiMutationMutated the arms of the alu domain by adding ACAC…PromoterT7Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-KAE1
Plasmid#232891PurposePlasmid expressing Cas9 and gRNA GATGACAACTGAATGCAGAG which targets the KAE1 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-SAM50
Plasmid#232895PurposePlasmid expressing Cas9 and gRNA AATAGTTTATGTAAGAACAG which targets the SAM50 gene.DepositorAvailable SinceApril 30, 2025AvailabilityAcademic Institutions and Nonprofits only -
SARS1_NSP13_BV_NBIO-TEV_CTHROM-his
Plasmid#234382PurposeBaculovirus expression for structure determination. May not contain entire coding region of gene.DepositorInsertNsp13_SARS
UseBaculovirus expresssionTagsLVPRGSGGSGHHHHHH and MSGLNDIFEAQKIEWHEGSAGGSGPromoterPolyhedrinAvailable SinceApril 18, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-ARB1
Plasmid#232888PurposePlasmid expressing Cas9 and gRNA CAAAAACTAACTGCTTACGG which targets the ARB1 gene.DepositorAvailable SinceMarch 11, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_DDX25
Plasmid#232359PurposeEnhancer near DDX25, chr11:125935511-125936012 cloned into pGL3DepositorInsertDDX25 (DDX25 Human)
UseLuciferaseAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_MSR1_bothneg0scramble
Plasmid#232383PurposeMSR1 enhancer, both buffering Coordinators scrambledDepositorAvailable SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pGL3_FAM153CP_SOX9rep
Plasmid#232400PurposeEnhancer near FAM153CP, buffering element replaced with SOX9 siteDepositorInsertFAM153CP (FAM153CP Human)
UseLuciferaseMutationEnhancer near FAM153CP, buffering element replace…Available SinceFeb. 27, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-RER2
Plasmid#232884PurposePlasmid expressing Cas9 and gRNA AGAATCGCATCTCTACACGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-LEU2-3
Plasmid#232894PurposePlasmid expressing Cas9 and gRNA GTTCTTAACTAGGATCATGG which targets the RER2 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-3
Plasmid#232886PurposePlasmid expressing Cas9 and gRNA GAAGTAACAAAGGAACCTAG which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML104-HygMx4-URA3-2
Plasmid#232885PurposePlasmid expressing Cas9 and gRNA TCGTACCACCAAGGAATTAC which targets the URA3 gene.DepositorAvailable SinceFeb. 26, 2025AvailabilityAcademic Institutions and Nonprofits only -
pZP05
Plasmid#232319PurposepZP05 was constructed by cloning the oriFn-repA fragment from pCWU6 into the smaller suicide plasmid pCM-galK, facilitating replication in Fusobacterium nucleatumDepositorInsertOri-repA
ExpressionBacterialAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only -
pML107-AVO1
Plasmid#232889PurposePlasmid expressing Cas9 and gRNA AATGATGACGACCATACCAG which targets the AVO1 gene.DepositorAvailable SinceFeb. 21, 2025AvailabilityAcademic Institutions and Nonprofits only