We narrowed to 20,028 results for: HAL
-
Plasmid#82517PurposeLentivirus vector. Expresses H2A-Halotag fusion proteins in mammalian cells.DepositorInsertHistone H2A
UseLentiviralTagsHaloTagExpressionMammalianPromoterCMVAvailable SinceJan. 30, 2017AvailabilityAcademic Institutions and Nonprofits only -
AtAUX1
Plasmid#117087Purposeprotein expression in yeastDepositorInsertAtAUX1
TagsHisExpressionYeastPromoterAOXAvailable SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
AtPIN2
Plasmid#117089Purposeprotein expression in yeastDepositorInsertAtPIN2
TagsHisExpressionYeastPromoterAOXAvailable SinceNov. 6, 2018AvailabilityAcademic Institutions and Nonprofits only -
HT7-mTurquoise2-KDEL
Plasmid#188571PurposeExpresses fluorescent HaloTag7-mTurquoise2 fusion protein in mammalian cells with localization in the endoplasmic reticulum.DepositorInsertHaloTag7
TagsKDEL and mTurquoise2ExpressionMammalianPromoterCMVAvailable SinceAug. 16, 2022AvailabilityAcademic Institutions and Nonprofits only -
TU#708
Plasmid#15277DepositorInsertczgfp
ExpressionWormMutationleucine zipper fused to c-terminal half of gfpAvailable SinceJune 23, 2008AvailabilityAcademic Institutions and Nonprofits only -
pAAV-double floxed-eNpHR-EYFP-WPRE-pA
Plasmid#20949PurposeCre-activated AAV expression of halorhodopsin 2.0 (eNpHR) fused to EYFP for optogenetic inhibitionDepositorHas ServiceAAV9Inserthalorhodopsin
UseAAVTagsEYFPExpressionMammalianPromoterEF1alphaAvailable SinceMay 13, 2009AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/PGC1
Plasmid#140416PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana PGC1 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana PGC1 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/MYB60
Plasmid#140417PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana MYB60 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana MYB60 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CAB3
Plasmid#140419PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CAB3 promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CAB3 and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1A
Plasmid#140420PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1A promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1A and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1B
Plasmid#140421PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1B promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1B and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1C
Plasmid#140422PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1C promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1C and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/CURT1D
Plasmid#140423PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by the A. thaliana CURT1D promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana CURT1D and A. thaliana UBQ10Available SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx2
Plasmid#82510PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cellsDepositorInsertChromobox Homolog 2 (CBX2 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromoteraggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaacc…Available SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ(M)-HT-Cbx8
Plasmid#82516PurposeLentivirus vector. Expresses halotag Cbx8fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 8 (CBX8 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromotercmvAvailable SinceDec. 20, 2016AvailabilityAcademic Institutions and Nonprofits only -
GS1.2/ADPGPP-350
Plasmid#140418PurposemApple expression regulated by the A. thaliana UBQ10 promoter, mCitrine expression regulated by a truncated A. thaliana ADPGPP promoter. nourseothricin acetyl transferase selectable marker (nat)DepositorInsertsmApple
mCitrine
UseSynthetic BiologyExpressionPlantPromoterA. thaliana UBQ10 and A. thaliana truncated ADPGPPAvailable SinceJuly 2, 2025AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx7
Plasmid#82515PurposeLentivirus vector. Expresses Halotag-Cbx7 fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 7 (CBX7 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromotercmvAvailable SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pCasperAUG-Gal4-X
Plasmid#8378DepositorInsertYeast Gal4 (GAL4 fused to first ~30 amino acids of Drosophila ADH, Budding Yeast)
UseDrosophila p-element vectorAvailable SinceApril 4, 2006AvailabilityAcademic Institutions and Nonprofits only -
pTRIPZ (M)-HT-Cbx6
Plasmid#82514PurposeLentivirus vector. Expresses Halotag-Cbx6 fusion proteins in mammalian cells.DepositorInsertChromobox Homolog 6 (CBX6 Human)
UseLentiviralTagsHaloTagExpressionMammalianPromotercmvAvailable SinceDec. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
Or46a-Gal4
Plasmid#63179PurposeExpresses Gal4 under control of the Drosophila melanogaster Or46a odorant receptor promoterDepositorInsertOr46a promoter
ExpressionInsectAvailable SinceApril 22, 2015AvailabilityAcademic Institutions and Nonprofits only