We narrowed to 12,273 results for: shRNA
-
Plasmid#87146PurposegapAP1 targeting guide RNA E. coli , Low Phosphate InductionDepositorInsertgapAP1 guide array
ExpressionBacterialPromoterE . coli ugpB gene promoter, low phosphate induct…Available SinceMarch 31, 2017AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF3_1
Plasmid#72363PurposeEncodes gRNA for 3' target of human ZNF3 along with Cas9 with 2A GFPDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
PX458_ZNF3_2
Plasmid#72364PurposeEncodes gRNA for 3' target of human ZNF3 along with Cas9 with 2A GFPDepositorInsertZNF3 (ZNF3 Human)
UseCRISPRAvailable SinceFeb. 1, 2016AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_TP73
Plasmid#214691PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human TP73DepositorInsertdgRNA_TP73 (TP73 Human)
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
pAG1guide_RUBY_EggCas9
Plasmid#225983PurposeTo make mutant alleles of AtAGAMOUS1 gene in Arabidopsis thaliana. The transgenics can be selected by red color appearance of plantsDepositorInsertGuide RNA against AtAGAMOUS1
UseCRISPRExpressionPlantPromoter35s promoter to Drive RUBY and DD45p to drive Cas9Available SinceOct. 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDual_dsCas9_Blast_hs_NC_chr1
Plasmid#214690PurposeLentiviral expression vector for an inducible Cas9-P2A-Blasticidin resistance casette with two sgRNA sequences against human non-coding DNA region of chromosome 1 (negative control)DepositorInsertdgRNA_Chr1
UseCRISPR and LentiviralAvailable SinceDec. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgSik1_1st-mU6-sgSik2-hU6-sgSik3_1st
Plasmid#177232PurposeExpresses Sik1(bU6), Sik2 (mU6) and Sik3 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgSik1_1st/sgSik2/sgSik3_1st
UseLentiviralPromoterbU6/mU6/hU6Available SinceJune 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgMark2-mU6-sgMark3-hU6-sgMark4
Plasmid#177235PurposeExpresses Mark2 (bU6), Mark3 (mU6) and Mark4 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgMark2/sgMark3/sgMark4
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgNeo2
Plasmid#177231PurposeExpresses neomycin gRNA's ( bU6 and hU6 ), non-targeting gRNA ( mU6 ) and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgNeo2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
pLKO.1-TRC.mKO2_shHuR CDS
Plasmid#110426PurposeTRCN0000276129 (Target CGAGCTCAGAGGTGATCAAAG), silence human ELAVL1 (HuR) gene and express monomeric Kusabira-Orange2.DepositorInsertELAVL1 HuR
UseLentiviral and RNAiExpressionMammalianPromoterU6 (RNA Pol III)Available SinceJune 20, 2018AvailabilityAcademic Institutions and Nonprofits only -
Lentiviral sgRNA human CD19
Plasmid#155289PurposeLentiviral expression of sgRNA against human CD19DepositorInsertCD19 (CD19 Human)
Available SinceAug. 31, 2020AvailabilityAcademic Institutions and Nonprofits only -
ipUSEPR-sg-Hs-PCNA
Plasmid#188686Purposecontrol sgRNADepositorAvailable SinceOct. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgSnrk
Plasmid#177236PurposeExpresses neomycin (bU6), non-targeting (mU6) and Snrk (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgSnrk
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNuak1-hU6-sgNuak2
Plasmid#177234PurposeExpresses Neomycin (bU6), Nuak1 (mU6) and Nuak2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNuak1/sgNuak2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 24, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgAmpk1-hU6-sgAmpk2
Plasmid#177233PurposeExpresses Neomycin (bU6), Ampk1 (mU6) and Ampk2(hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgPrkaa1/sgPrkaa2
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgLkb1_2nd
Plasmid#177230PurposeExpresses Neomycin(bU6), non-targeting (mU6) and Lkb1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgLkb1_2nd
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
bU6-sgNeo1-mU6-sgNT-hU6-sgLkb1_1st
Plasmid#177227PurposeExpresses Neomycin(bU6), non-targeting (mU6) and Lkb1 (hU6) gRNAs and Cre-recombinaseDepositorInsertsgNeo1/sgNT1/sgLkb1_1st
UseLentiviralPromoterbU6/mU6/hU6Available SinceJan. 21, 2022AvailabilityAcademic Institutions and Nonprofits only -
Flag-TRIM24-F979A/N980A shRescue
Plasmid#28143DepositorInsertTRIM24 (TRIM24 Human)
TagsFLAGX2ExpressionMammalianMutationA489V, F979A and N980A; aa 308 and 309 mutated fo…Available SinceFeb. 10, 2012AvailabilityAcademic Institutions and Nonprofits only -
Flag-TRIM24-F869D/F979A/N980A shRescue
Plasmid#28145DepositorInsertTRIM24 (TRIM24 Human)
TagsFLAGX2ExpressionMammalianMutationF869D, F979A, N980A and aa 308 and 309 mutated fo…Available SinceJune 6, 2011AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPRv2_mPTK7-gRNA3
Plasmid#249198Purposemouse PTK7 CRISPR KODepositorAvailable SinceFeb. 17, 2026AvailabilityAcademic Institutions and Nonprofits only