1,878 results
-
Plasmid#200765PurposeExpresses mKate2-tag fused CDC-42 with 8xMS2(V1) stem loops in C. elegans, and the tissue-specific promoter col-19 is used.DepositorInsert8xMS2
TagsmKate2ExpressionWormPromotercol-19Available sinceAug. 5, 2024AvailabilityAcademic Institutions and Nonprofits only -
-
-
pDV21 [pSNG-1::SNG-1::CRY2(D387A)olig(535)::SL2::mCherry]
Plasmid#197599PurposePan-neuronal expression of SNG-1::CRY2(D387A)olig(535) in neurons of C. elegans. CRY2(D387A) is photoinactiveDepositorExpressionWormMutationD387A, E490GAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV18 [punc-47::SNG-1::CRY2olig(535)]
Plasmid#197598PurposeExpression of SNG-1::CRY2olig(535) in GABAergic motor neurons of C. elegansDepositorExpressionWormMutationE490GAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDV12 [psng-1::SNG-1::CRY2olig(535)]
Plasmid#197596PurposePan-neuronal expression of SNG-1::CRY2olig(535) in neurons of C. elegansDepositorExpressionWormMutationE490GAvailable sinceJuly 10, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4293
Plasmid#200161PurposePtwk-40s GCaMP6s::mNeptune unc-54 3' UTR C.elegans AVA,AVB and other neurons expression of GCaMP6 mNeptuneDepositorInsertGCaMP6
TagsmNeptuneExpressionWormPromoterPtwk-40Available sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4316
Plasmid#200171PurposePflp-18 LoxP EBFP (stop) LoxP twk-40(gf) GFP unc-54 3' UTR C.elegans AVA and other neurons expression of twk-40(gf) GFPDepositorAvailable sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4506
Plasmid#200255PurposePnpr-4 TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
TagsmCherryExpressionWormPromoterPnpr-4Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4508
Plasmid#200256PurposePflp-18 LoxP EBFP LoxP TeTx mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of TeTx RFPDepositorInsertTeTx
TagsmCherryExpressionWormPromoterPflp-18Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4562
Plasmid#200780PurposePflp-18 LoxP EBFP LoxP GtACR2 mCherry unc-54 3' UTR C.elegans AVA and other neurons expression of GtACR2 RFPDepositorInsertGtAR2
TagsmCherryExpressionWormPromoterPflp-18Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4609
Plasmid#200781PurposePpdf-1 LoxP EBFP LoxP GtACR2 mCherry unc-54 3' UTR C.elegans AVB and other neurons expression of GtACR2 RFPDepositorInsertGtACR2
TagsmCherryExpressionWormPromoterPpdf-1Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4677
Plasmid#200782PurposePnpr-4 ins-22::GFP unc-54 3' UTR C.elegans AVA and other neurons expression of ins-22 GFPDepositorAvailable sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH4693
Plasmid#200784PurposePtwk-40s EGFP unc-54 3' UTR C.elegans AVA and other neurons expression of EGFPDepositorInsertno
TagsGFPExpressionWormPromoterPtwk-40sAvailable sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH2673
Plasmid#199691PurposePnmr-1 FLPe unc-54 3' UTR C.elegans AVA/E/D premotor IN and others expression of FLPeDepositorAvailable sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pJH2829
Plasmid#199693PurposePcex-1 tomm-20::miniSOG UrSL mCherry unc-54 3' UTR C.elegans RIM neuron expression of miniSOG RFPDepositorInsertminiSOG
TagsRFPExpressionWormPromoterPcex-1Available sinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
pJH4018
Plasmid#200043PurposePrig-3 FRT let858 (stop) FRT zif-1 SL2 EBFP unc-54 3' UTR C.elegans AVA and other neurons expression of zif EBFPDepositorAvailable sinceMay 7, 2024AvailabilityIndustry, Academic Institutions, and Nonprofits -
pMS18
Plasmid#215675PurposeCas9 + guide plasmid for inserting ChrI split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GAAATCGCCGACTTGCGAGG
UseCRISPRExpressionWormAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS62
Plasmid#215676PurposeCas9 + guide plasmid for inserting ChrIII split hygromycinR landing padDepositorInserteef-1A.1p::Cas9 + U6p::GTCGTTCTTCCGTTCTCGGG
UseCRISPRExpressionWormAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only -
pMS161
Plasmid#215683PurposeGuide only plasmid targeting chrIII split hygromycinR landing padDepositorInsertU6p::GTCCAGCGGCAGATCGGCGG
UseCRISPRExpressionWormAvailable sinceMarch 25, 2024AvailabilityAcademic Institutions and Nonprofits only