We narrowed to 868 results for: V2
-
Plasmid#191111PurposeAn E. coli sfGFP reporter with two TAG at positions 2 & 134DepositorInsertsuperfolder green fluorescence protein
TagsHis tagExpressionBacterialMutationchanging V2 & D134 to TAGAvailable SinceNov. 21, 2024AvailabilityAcademic Institutions and Nonprofits only -
pDest17_A1-LCD swap V2
Plasmid#226539PurposeBacterial expression of N-terminally 6His tagged A1-LCD V2DepositorInsertA1-LCD swap V2
Tags6xHisExpressionBacterialPromoterT7Available SinceNov. 19, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro SPNS1_sg2
Plasmid#218531PurposesgRNA targeting human SPNS1DepositorInsertSPNS1 (SPNS1 Human)
UseCRISPR and LentiviralAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro FLVCR1_sg5
Plasmid#218522PurposesgRNA targeting human FLVCR1DepositorInsertFLVCR1 (FLVCR1 Human)
UseCRISPR and LentiviralAvailable SinceMay 7, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro SPNS1_sg1
Plasmid#218530PurposesgRNA targeting human SPNS1DepositorInsertSPNS1 (SPNS1 Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
plentiCRISPR-v2 Puro CHKA_sg2
Plasmid#218523PurposesgRNA targeting human CHKADepositorInsertCHKA (CHKA Human)
UseCRISPR and LentiviralAvailable SinceMay 6, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-SF14P
Plasmid#209448Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the SF14P promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from SF14P promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCRISPR-cBEST-v2-kasOP*
Plasmid#209447Purposeimproved pCRISPR-cBEST plasmid with optimized sgRNA cloning site and expression of the sgRNA from the kasOP* promoterDepositorInsertCodon optimized APOBEC1-nCas9-UGI fusion protein
UseCRISPR and Synthetic BiologyPromoterPtipA; sgRNA expression from kasOP* promoterAvailable SinceMarch 13, 2024AvailabilityAcademic Institutions and Nonprofits only -
pLentiCRISPR-v2 hygro sgUCK1
Plasmid#211524PurposeDeletes UCK1DepositorInsertsgUCK1
UseCRISPR and LentiviralExpressionMammalianAvailable SinceJan. 8, 2024AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-rCD20-BSD
Plasmid#209753PurposeTo reconstitute CD20 expression with a specific mRNA isoform (variant 2) after CRISPR-Cas9-mediated knockout of CD20.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralMutationThe CCTGGGGGGTCTTCTGATGATCC sequence within the C…Available SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
pCDH-V2-CD20-Puro
Plasmid#209756PurposeLentiviral transfer plasmid to express the 5'-UTR and CDS of the human CD20 gene, MS4A1. Specifically, the variant 2 mRNA isoform.DepositorInsertMS4A1 (MS4A1 Human)
UseLentiviralAvailable SinceNov. 30, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgABI2-1
Plasmid#210139Purposeknock out ABI2 in mammalian cellsDepositorInsertAbl interactor 2 (ABI2 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCYFIP1-1
Plasmid#210137Purposeknock out CYFIP1 in mammalian cellsDepositorInsertCytoplasmic FMR1-interacting protein 1 (CYFIP1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgABI2-2
Plasmid#210140Purposeknock out ABI2 in mammalian cellsDepositorInsertAbl interactor 2 (ABI2 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgWAVE2-2
Plasmid#210136Purposeknock out WAVE2 in mammalian cellsDepositorInsertActin-binding protein WASF2 (WASF2 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgWAVE2-1
Plasmid#210135Purposeknock out WAVE2 in mammalian cellsDepositorInsertActin-binding protein WASF2 (WASF2 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgHSPC300-1
Plasmid#210141Purposeknock out HSPC300 in mammalian cellsDepositorInsertProtein BRICK1 (BRK1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgHSPC300-2
Plasmid#210142Purposeknock out HSPC300 in mammalian cellsDepositorInsertProtein BRICK1 (BRK1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
lentiCRISPR v2-sgCYFIP1-2
Plasmid#210138Purposeknock out CYFIP1 in mammalian cellsDepositorInsertCytoplasmic FMR1-interacting protein 1 (CYFIP1 Human)
UseCRISPRAvailable SinceNov. 8, 2023AvailabilityAcademic Institutions and Nonprofits only -
pUC57-mini v2-HF24_F4
Plasmid#195718PurposeThis plasmid carries a fragment from a 24-fragment lacI/lacZ cassette split that was designed as a Golden Gate assembly with high fidelity.DepositorInsertFragment#4 of 24 fragment splits in lacI/lacZ cassette
UseSynthetic BiologyAvailable SinceMarch 20, 2023AvailabilityIndustry, Academic Institutions, and Nonprofits