We narrowed to 11,564 results for: phen
-
Plasmid#186403PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter ECFP under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only
-
pDEST-pSP172BSSPE-Swa1::RfA-ECFP
Plasmid#186402PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter eCFP under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::RfA-venus
Plasmid#186401PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter Venus under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-pFOGc::venus-RfA
Plasmid#186400PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of the pFOG ectodermal regulatory sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 30, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::venus-RfA
Plasmid#186398PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of N-ter Venus and a gene of interest under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceSept. 29, 2022AvailabilityAcademic Institutions and Nonprofits only -
pA-RFP-rG2
Plasmid#188969PurposeIPTG inducible mCherry with sgRNADepositorInsertsmCherry
sgRNA: agtccatgtaatcagcgtctactagt
UseSynthetic BiologyExpressionBacterialPromoterPtrcAvailable SinceSept. 22, 2022AvailabilityAcademic Institutions and Nonprofits only -
pTE1069
Plasmid#186629PurposeSCB-GFP E. coli reporter plasmid. Encodes repressor ScbR and ScbAp promoter upstream of GFP.DepositorInsertsscbR
scbAp promoter
UseSynthetic BiologyTags6xArgExpressionBacterialPromoterBBa_J23100 and scbApAvailable SinceSept. 7, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-Swa1::RfA-HA
Plasmid#186405PurposeDestination vector for ascidian transgenesis by electroporation of a Gateway-cloned fusion of a gene of interest with a C-ter HA tag under control of a reg. sequence in the Swa1 restriction site.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-venus
Plasmid#186409PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion N-ter Venus-gene of interest under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only -
pDEST-pSP172BSSPE-R3-ccdB/CmR-R5::RfA-HA
Plasmid#186410PurposeMultisite destination vector for ascidian electroporation of an AttB1/B2 recombined fusion gene of interest-C-ter HA tag under control of an AttB3/B5 recombined reg. sequence.DepositorTypeEmpty backboneUseGateway destination vectorAvailable SinceAug. 9, 2022AvailabilityAcademic Institutions and Nonprofits only